HUGE

Gene/Protein Characteristic Table for KIAA1235

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04168
Accession No. :	AB033061
Description :	AT-rich interactive domain-containing protein 1B.
HUGO Gene Name :	AT rich interactive domain 1B (SWI1-like) (ARID1B)
Clone Name :	fh08704 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5834 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1376 bp

Genome contig ID gi89161210f_157395934
PolyA signal sequence
(AATAAA,-34)
+----*----+----*----+----*----+----
GAATAAATGTACATTAAATCTTGTTAAGCACTGTG
Flanking genome sequence
(176161 - 176210)
----+----*----+----*----+----*----+----*----+----*
ATGGGTGTTCTTGAATACTGTTCTAGTTTCCTTAAAGTGGTTTCCTAGTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 157495934 157572093 14 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1485 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI42305	99.9	novel protein [...	Homo sapiens
EAW47678	99.9	AT rich interac...	Homo sapiens
XP_001133842	99.9	hypothetical pr...	Homo sapiens
EDL01654	94.3	mCG5693 [Mus mu...	Mus musculus
NP_001078824	94.3	AT rich interac...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001606 299 404 PF01388 AT-rich interaction region

HMMSmart IPR001606 303 394 SM00501 AT-rich interaction region

ProfileScan IPR001606 302 393 PS51011 AT-rich interaction region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001606	299	404	PF01388	AT-rich interaction region
HMMSmart	IPR001606	303	394	SM00501	AT-rich interaction region
ProfileScan	IPR001606	302	393	PS51011	AT-rich interaction region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GAGGTATGTCGGTCAGTAGTC

Primer_r
: CGTTGTCAGGTATGTATTCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GAGGTATGTCGGTCAGTAGTC
Primer_r	: CGTTGTCAGGTATGTATTCTC
PCR product length	: 122 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1376 bp
Genome contig ID	gi89161210f_157395934
PolyA signal sequence (AATAAA,-34)	+--------+--------+----*----+---- GAATAAATGTACATTAAATCTTGTTAAGCACTGTG
Flanking genome sequence (176161 - 176210)	----+--------+--------+--------+--------+----* ATGGGTGTTCTTGAATACTGTTCTAGTTTCCTTAAAGTGGTTTCCTAGTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	157495934	157572093	14	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA1235

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information