HUGE |
Gene/Protein Characteristic Table for KIAA1236 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05753 |
---|---|
Accession No. : | AB033062 |
Description : | kinesin family member 26A. |
HUGO Gene Name : | kinesin family member 26A (KIF26A) |
Clone Name : | pg00641 [Vector Info] |
Source : | Human brain (hippocampus) |
Note : | We replaced fh08822, former representative clones for KIAA1236 with pg00641. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6627 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1104 bp Genome contig ID gi51511730f_103575217 PolyA signal sequence
(ATTAAA,-21) +----*----+----*----+----*----+----
GCTTTTATTTGTGAATTAAAGATGCATCGATGGTTFlanking genome sequence
(141769 - 141818) ----+----*----+----*----+----*----+----*----+----*
CCCACGGCTGCCGAGTTCACTGGGCGTCGGCAGACTCCTCACGCCCTGGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 14 f 103675217 103716984 14 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1840 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TTGCCGTGGGAATTTGAAGAC | |
: AAGTATGAGCCTGTCGTGCGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 14 |
: GeneBridge 4 | |
: TTGCCGTGGGAATTTGAAGAC | |
: AAGTATGAGCCTGTCGTGCGG | |
: 216 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |