HUGE

Gene/Protein Characteristic Table for KIAA0042

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01049
Accession No. :	D26361
Description :	Kinesin-like protein KIF14.
HUGO Gene Name :	kinesin family member 14 (KIF14)
Clone Name :	ha00930 [Vector Info]
Flexi ORF Clone :	pF1KA0042
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 6586 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1200 bp

Genome contig ID gi89161185r_198687930
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GTGATATTGAGCAGTTCCTAAAGAATAATTCATTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAGAAGAAAAAAAAAGAAGAATTCATTTAAATAACCTGATCCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 198787930 198856485 30 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1652 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q15058	100.0	Kinesin-like pr...	Homo sapiens
AAI13743	99.9	Kinesin family ...	Homo sapiens
EAW91317	99.9	kinesin family ...	Homo sapiens
XP_001109736	93.1	kinesin family ...	Macaca mulatta
XP_547369	81.3	similar to Kine...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046810	3.6e-54	40.9	KIAA1590
AB014539	3.7e-48	36.8	KIAA0639
AB014606	1.3e-39	42.1	KIAA0706
AB040881	2.4e-39	36.2	KIAA1448
AB011163	4.5e-38	34.4	KIAA0591

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001752 442 463 PR00380 Kinesin

IPR001752 565 582 PR00380 Kinesin

IPR001752 602 620 PR00380 Kinesin

IPR001752 655 676 PR00380 Kinesin

HMMPfam IPR001752 368 706 PF00225 Kinesin

IPR000253 829 895 PF00498 Forkhead-associated

HMMSmart IPR001752 360 713 SM00129 Kinesin

IPR000253 828 880 SM00240 Forkhead-associated

ProfileScan IPR001752 359 632 PS50067 Kinesin

ScanRegExp IPR001752 601 612 PS00411 Kinesin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	442	463	PR00380	Kinesin
IPR001752	565	582	PR00380	Kinesin
IPR001752	602	620	PR00380	Kinesin
IPR001752	655	676	PR00380	Kinesin
HMMPfam	IPR001752	368	706	PF00225	Kinesin
IPR000253	829	895	PF00498	Forkhead-associated
HMMSmart	IPR001752	360	713	SM00129	Kinesin
IPR000253	828	880	SM00240	Forkhead-associated
ProfileScan	IPR001752	359	632	PS50067	Kinesin
ScanRegExp	IPR001752	601	612	PS00411	Kinesin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: Stanford G3
Primer_f	: CCAAAGAAGAACACCAACAAT
Primer_r	: CACACCCACTGAATCCTACTG
PCR product length	: 145 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1200 bp
Genome contig ID	gi89161185r_198687930
PolyA signal sequence (None)	+--------+--------+----*----+---- GTGATATTGAGCAGTTCCTAAAGAATAATTCATTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAGAAGAAAAAAAAAGAAGAATTCATTTAAATAACCTGATCCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	198787930	198856485	30	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0042

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information