HUGE

Gene/Protein Characteristic Table for KIAA1448

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01166
Accession No. :	AB040881
Description :	Kinesin-like protein KIF1B.
HUGO Gene Name :
Clone Name :	fh12320y1 [Vector Info]
Flexi ORF Clone :	pF1KA1448
Source :	Human fetal brain
Note :	We replaced fh12320, former representative clones for KIAA1448 with fh12320y1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 5883 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2110 bp

Genome contig ID gi89161185f_10113409
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTGCAGCCAGGACAACAGAGTGAGAACCTGTCTTT
Flanking genome sequence
(175995 - 176044)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAAAAGGTAATATTTATTATATTATTCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 10213409 10289402 21 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1179 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI95222	100.0	kinesin family ...	Homo sapiens
AAK85155	98.8	kinesin superfa...	Homo sapiens
CAM18594	95.7	kinesin family ...	Mus musculus
BAA04503	95.2	Kif1b [Mus musc...	Mus musculus
EAW71645	100.0	kinesin family ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011163	3.8e-106	92.4	KIAA0591
AB014606	2.4e-88	62.2	KIAA0706
AB014539	1.4e-59	48.1	KIAA0639
AB046810	5.3e-53	35.3	KIAA1590
D26361	1.5e-48	36.2	KIAA0042

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001752 114 135 PR00380 Kinesin

IPR001752 234 251 PR00380 Kinesin

IPR001752 269 287 PR00380 Kinesin

IPR001752 324 345 PR00380 Kinesin

HMMPfam IPR001752 37 375 PF00225 Kinesin

IPR000253 536 607 PF00498 Forkhead-associated

HMMSmart IPR001752 29 382 SM00129 Kinesin

IPR000253 535 592 SM00240 Forkhead-associated

ProfileScan IPR001752 28 299 PS50067 Kinesin

IPR000253 536 592 PS50006 Forkhead-associated

ScanRegExp IPR001752 268 279 PS00411 Kinesin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	114	135	PR00380	Kinesin
IPR001752	234	251	PR00380	Kinesin
IPR001752	269	287	PR00380	Kinesin
IPR001752	324	345	PR00380	Kinesin
HMMPfam	IPR001752	37	375	PF00225	Kinesin
IPR000253	536	607	PF00498	Forkhead-associated
HMMSmart	IPR001752	29	382	SM00129	Kinesin
IPR000253	535	592	SM00240	Forkhead-associated
ProfileScan	IPR001752	28	299	PS50067	Kinesin
IPR000253	536	592	PS50006	Forkhead-associated
ScanRegExp	IPR001752	268	279	PS00411	Kinesin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TACATCGTTCCTCATCTCTTG

Primer_r
: CCTTGAATGCTAACTGCTATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2110 bp
Genome contig ID	gi89161185f_10113409
PolyA signal sequence (None)	+--------+--------+----*----+---- CTGCAGCCAGGACAACAGAGTGAGAACCTGTCTTT
Flanking genome sequence (175995 - 176044)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAAAGGTAATATTTATTATATTATTCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	10213409	10289402	21	99.9	Perfect prediction

Primer_f	: TACATCGTTCCTCATCTCTTG
Primer_r	: CCTTGAATGCTAACTGCTATC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1448

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information