HUGE

Gene/Protein Characteristic Table for KIAA0639

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00585
Accession No. :	AB014539
Description :	Kinesin-like protein KIF13B.
HUGO Gene Name :	kinesin family member 13B (KIF13B)
Clone Name :	fg02716y2 [Vector Info]
Flexi ORF Clone :	pF1KSDA0639
Source :	Human fetal brain
Note :	We replaced hj03358 and fg02716, former representative clones for KIAA0639 with fg02716y2. (2002/12/27,2003/4/2)

Features of the cloned DNA sequence	Description

Length: 8735 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3225 bp

Genome contig ID gi51511724r_28880715
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
AGCTTCTCAATAAAACCAGACCATTTCTCACCTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCATGTCTGAGGCCAGTCTTGTTGCTTCTCCTTCCCCTCACCCCAACAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 r 28980715 29176499 39 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1835 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09788	100.0	kinesin family ...	synthetic construct
Q9NQT8	99.6	Kinesin-like pr...	Homo sapiens
EAW63491	97.2	kinesin family ...	Homo sapiens
XP_534562	89.2	similar to kine...	Canis lupus fam...
EAW63486	97.1	kinesin family ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014606	2.2e-30	47.2	KIAA0706
AB040881	3.5e-30	48.3	KIAA1448
D26361	5.6e-30	36.8	KIAA0042
AB046810	5.8e-30	39.2	KIAA1590
AB011163	1.4e-29	40.8	KIAA0591

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001752 103 124 PR00380 Kinesin

IPR001752 222 239 PR00380 Kinesin

IPR001752 257 275 PR00380 Kinesin

IPR001752 312 333 PR00380 Kinesin

HMMPfam IPR001752 20 363 PF00225 Kinesin

IPR000253 480 544 PF00498 Forkhead-associated

IPR000938 1712 1777 PF01302 CAP-Gly

HMMSmart IPR001752 12 370 SM00129 Kinesin

ProfileScan IPR001752 11 287 PS50067 Kinesin

IPR000938 1730 1772 PS50245 CAP-Gly

ScanRegExp IPR001752 256 267 PS00411 Kinesin

IPR000938 1730 1761 PS00845 CAP-Gly

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	103	124	PR00380	Kinesin
IPR001752	222	239	PR00380	Kinesin
IPR001752	257	275	PR00380	Kinesin
IPR001752	312	333	PR00380	Kinesin
HMMPfam	IPR001752	20	363	PF00225	Kinesin
IPR000253	480	544	PF00498	Forkhead-associated
IPR000938	1712	1777	PF01302	CAP-Gly
HMMSmart	IPR001752	12	370	SM00129	Kinesin
ProfileScan	IPR001752	11	287	PS50067	Kinesin
IPR000938	1730	1772	PS50245	CAP-Gly
ScanRegExp	IPR001752	256	267	PS00411	Kinesin
IPR000938	1730	1761	PS00845	CAP-Gly

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TTCCTGCCCAAGATACTGACC

Primer_r
: CGAATCCACACATAGAGAAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTCCTGCCCAAGATACTGACC
Primer_r	: CGAATCCACACATAGAGAAGC
PCR product length	: 135 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3225 bp
Genome contig ID	gi51511724r_28880715
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- AGCTTCTCAATAAAACCAGACCATTTCTCACCTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCATGTCTGAGGCCAGTCTTGTTGCTTCTCCTTCCCCTCACCCCAACAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	r	28980715	29176499	39	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0639

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information