HUGE |
Gene/Protein Characteristic Table for KIAA0639 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00585 |
---|---|
Accession No. : | AB014539 |
Description : | Kinesin-like protein KIF13B. |
HUGO Gene Name : | kinesin family member 13B (KIF13B) |
Clone Name : | fg02716y2 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0639
![]() |
Source : | Human fetal brain |
Note : | We replaced hj03358 and fg02716, former representative clones for KIAA0639 with fg02716y2. (2002/12/27,2003/4/2) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 8735 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3225 bp Genome contig ID gi51511724r_28880715 PolyA signal sequence
(AATAAA,-27) +----*----+----*----+----*----+----
AGCTTCTCAATAAAACCAGACCATTTCTCACCTGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATCATGTCTGAGGCCAGTCTTGTTGCTTCTCCTTCCCCTCACCCCAACAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 8 r 28980715 29176499 39 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1835 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: TTCCTGCCCAAGATACTGACC | |
: CGAATCCACACATAGAGAAGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 8 |
: GeneBridge 4 | |
: TTCCTGCCCAAGATACTGACC | |
: CGAATCCACACATAGAGAAGC | |
: 135 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |