| HUGE |
Gene/Protein Characteristic Table for KIAA0706 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | |
| Product ID : | ORK01112 |
|---|---|
| Accession No. : | AB014606 |
| Description : | Kinesin-like protein KIF1C. |
| HUGO Gene Name : | |
| Clone Name : | pj01355 [Vector Info] |
| Flexi ORF Clone : | pF1KA0706
|
| Source : | Human brain (hippocampus) |
| Note : | We replaced hg04286, former representative clones for KIAA0706 with pj01355. (2004/1/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4218 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 553 bp Genome contig ID gi51511734f_4741971 PolyA signal sequence
(AATAAA,-21)
GATGTGGGCCCTTTAATAAAGGATAGCAAACAGGGFlanking genome sequence
(126752 - 126801)
AGCTTGTGGCCTGTTTGTTTTGGGTTTTCATGGAGGTGTAGGTTATATAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 f 4841971 4868721 23 99.7 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1123 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
