HUGE

Gene/Protein Characteristic Table for KIAA1243

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06001
Accession No. :	AB033069
Description :	MKL/myocardin-like protein 2.
HUGO Gene Name :
Clone Name :	pf00817 [Vector Info]
Source :	Human brain (hippocampus)
Note :	We replaced he00844, former representative clones for KIAA1243 with pf00817. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 7815 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5328 bp

Genome contig ID gi51511732f_14141593
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CATTTTTGTGTCTCAAATAAAAGACATTTTGATGT
Flanking genome sequence
(126539 - 126588)
----+----*----+----*----+----*----+----*----+----*
ACTATGATTCTTGCTGTGCAGAGGAAAGACCACTCCCTATGGGTTGGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 14235624 14268130 9 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 828 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULH7	100.0	MKL/myocardin-l...	Homo sapiens
EAW85112	100.0	MKL/myocardin-l...	Homo sapiens
XP_001146854	97.1	megakaryoblasti...	Pan troglodytes
XP_001146728	97.1	megakaryoblasti...	Pan troglodytes
XP_547119	87.3	similar to MKL/...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037859	3.5e-10	38.4	KIAA1438

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003034 129 163 PF02037 DNA-binding SAP

HMMSmart IPR003034 129 163 SM00513 DNA-binding SAP

ProfileScan IPR003034 129 163 PS50800 DNA-binding SAP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003034	129	163	PF02037	DNA-binding SAP
HMMSmart	IPR003034	129	163	SM00513	DNA-binding SAP
ProfileScan	IPR003034	129	163	PS50800	DNA-binding SAP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACAGAGCTTTATGCCAACTAC

Primer_r
: TTCCTAAATGCTTCCTCTTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACAGAGCTTTATGCCAACTAC
Primer_r	: TTCCTAAATGCTTCCTCTTCC
PCR product length	: 134 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	5328 bp
Genome contig ID	gi51511732f_14141593
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CATTTTTGTGTCTCAAATAAAAGACATTTTGATGT
Flanking genome sequence (126539 - 126588)	----+--------+--------+--------+--------+----* ACTATGATTCTTGCTGTGCAGAGGAAAGACCACTCCCTATGGGTTGGTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	14235624	14268130	9	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA1243

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information