HUGE |
Gene/Protein Characteristic Table for KIAA1438 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00835 |
---|---|
Accession No. : | AB037859 |
Description : | MKL/myocardin-like protein 1. |
HUGO Gene Name : | megakaryoblastic leukemia (translocation) 1 (MKL1) |
Clone Name : | hk07374s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1438 |
Source : | Human adult brain |
Note : | We replaced hk07374, former representative clones for KIAA1438 with hk07374s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4494 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1101 bp Genome contig ID gi89161203r_39036239 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TGTGTGAACTTTTTAAAATAAACACAAAAACACAGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
GCCTGTTAGTCCATCTTATTCAGTCCATGGAAGGGGTGGGTAGCACAGCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 r 39136239 39362641 15 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1075 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CCCTGCCATTTTAGTGTCTTG | |
: AGTAGGATGGGAGGGAGTTGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 22 |
: GeneBridge 4 | |
: CCCTGCCATTTTAGTGTCTTG | |
: AGTAGGATGGGAGGGAGTTGC | |
: 159 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |