HUGE

Gene/Protein Characteristic Table for KIAA1279

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00795
Accession No. :	AB033105
Description :
HUGO Gene Name :
Clone Name :	hh00842s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1279
Source :	Human adult brain
Note :	We replaced hh00842, former representative clones for KIAA1279 with hh00842s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 2463 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 562 bp

Genome contig ID gi89161187f_70318560
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TTAGAAATAAAATAAACTGACTTATTTCACTAATG
Flanking genome sequence
(128182 - 128231)
----+----*----+----*----+----*----+----*----+----*
AAAACTTCTGTTTCCTTTTTGTTTTCTTGTGAGCACTGATACCTCAATAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 70418560 70446740 7 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 632 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAF84032	99.4	unnamed protein...	Homo sapiens
XP_536374	94.8	similar to CG14...	Canis lupus fam...
XP_001503692	95.8	similar to KIF1...	Equus caballus
XP_001928845	93.7	similar to KIF1...	Sus scrofa
Q6ZPU9	91.8	KIF1-binding pr...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACATTGAGGAAAGCCAGGCAG

Primer_r
: ACTTGTATGGTTCCTTCTCCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACATTGAGGAAAGCCAGGCAG
Primer_r	: ACTTGTATGGTTCCTTCTCCG
PCR product length	: 135 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	562 bp
Genome contig ID	gi89161187f_70318560
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TTAGAAATAAAATAAACTGACTTATTTCACTAATG
Flanking genome sequence (128182 - 128231)	----+--------+--------+--------+--------+----* AAAACTTCTGTTTCCTTTTTGTTTTCTTGTGAGCACTGATACCTCAATAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	70418560	70446740	7	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA1279

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information