HUGE

Gene/Protein Characteristic Table for KIAA1281

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00796
Accession No. :	AB033107
Description :	Zinc finger protein 608.
HUGO Gene Name :	zinc finger protein 608 (ZNF608)
Clone Name :	hh04108s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1281
Source :	Human adult brain
Note :	We replaced hh04108, former representative clones for KIAA1281 with hh04108s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5646 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 983 bp

Genome contig ID gi51511721r_123900526
PolyA signal sequence
(ATTAAA,-26)
+----*----+----*----+----*----+----
GCAATCAGAATTAAAAAGTTTTTTTTTTTTTAAAT
Flanking genome sequence
(99983 - 99934)
----+----*----+----*----+----*----+----*----+----*
AATGGCTTCTTGTCTGTCTCATGTTATTTTCTACCTGGCTGATAGTCATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 r 124000509 124108704 9 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1534 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULD9	100.0	Zinc finger pro...	Homo sapiens
NP_065798	99.9	zinc finger pro...	Homo sapiens
XP_001155805	99.7	zinc finger pro...	Pan troglodytes
XP_001094294	99.2	similar to zinc...	Macaca mulatta
XP_001504551	97.0	similar to Zinc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002293	2.2e-11	43.4	KIAA0295

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR007087 577 600 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR007087	577	600	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCACGTATGGCAGTAGCAAGC

Primer_r
: ACTCCTCTGTTACCTAATTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCACGTATGGCAGTAGCAAGC
Primer_r	: ACTCCTCTGTTACCTAATTCC
PCR product length	: 156 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	983 bp
Genome contig ID	gi51511721r_123900526
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- GCAATCAGAATTAAAAAGTTTTTTTTTTTTTAAAT
Flanking genome sequence (99983 - 99934)	----+--------+--------+--------+--------+----* AATGGCTTCTTGTCTGTCTCATGTTATTTTCTACCTGGCTGATAGTCATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	r	124000509	124108704	9	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1281

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information