HUGE |
Gene/Protein Characteristic Table for KIAA1284 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00797 |
---|---|
Accession No. : | AB033110 |
Description : | PDZ domain-containing protein 6. |
HUGO Gene Name : | inturned planar cell polarity effector homolog (Drosophila) (INTU) |
Clone Name : | hh09454s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1284
![]() |
Source : | Human adult brain |
Note : | We replaced hh09454, former representative clones for KIAA1284 with hh09454s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3238 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 339 bp Genome contig ID gi89161207f_128673570 PolyA signal sequence
(AATATA,-29) +----*----+----*----+----*----+----
CAGATTAATATAGGAAATGTTTATTCTTGAAAAATFlanking genome sequence
(183812 - 183861) ----+----*----+----*----+----*----+----*----+----*
ACTCAATTTGTTGTTGTTTATTTTTCTCAAAATTCATACTGATATCTGAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 4 f 128773570 128857380 16 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 953 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CAGATAGCTTGACCACTTCGC | |
: AACCATTGTCAGATCCTCCAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 4 |
: GeneBridge 4 | |
: CAGATAGCTTGACCACTTCGC | |
: AACCATTGTCAGATCCTCCAC | |
: 156 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |