HUGE

Gene/Protein Characteristic Table for KIAA1285

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB033111
Description :	zinc finger protein 777.
HUGO Gene Name :	zinc finger protein 777 (ZNF777)
Clone Name :	hh11563 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6016 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 14 bp

Genome contig ID gi89161213r_148660048
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGC
Flanking genome sequence
(228853 - 228804)
----+----*----+----*----+----*----+----*----+----*
GTGAAACCCCGTCTCTACTAAAAATATAAAAATTTGCCGTGTGTGGTGGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 148760038 148788900 6 99.6 Terminal No-hit

Features of the protein sequence	Description

Length: 785 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULD5	100.0	Zinc finger pro...	Homo sapiens
XP_001095994	97.9	similar to zinc...	Macaca mulatta
XP_001916084	93.8	zinc finger pro...	Equus caballus
XP_539902	89.9	similar to zinc...	Canis lupus fam...
XP_595668	90.9	zinc finger pro...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002324	5.1e-16	49.3	KIAA0326
AB095924	4.1e-15	32.0	KIAA2003
AB018341	6e-15	33.1	KIAA0798
AB107355	6.9e-15	30.9	KIAA2033
AB075827	1.1e-14	46.0	KIAA1947

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 663 684 PD000003 Zinc finger

IPR007087 719 742 PD000003 Zinc finger

HMMPfam IPR001909 310 350 PF01352 KRAB box

IPR007087 571 593 PF00096 Zinc finger

IPR007087 599 621 PF00096 Zinc finger

IPR007087 661 683 PF00096 Zinc finger

IPR007087 689 711 PF00096 Zinc finger

IPR007087 719 741 PF00096 Zinc finger

IPR007087 747 769 PF00096 Zinc finger

HMMSmart IPR001909 310 370 SM00349 KRAB box

IPR015880 571 593 SM00355 Zinc finger

IPR015880 599 621 SM00355 Zinc finger

IPR015880 661 683 SM00355 Zinc finger

IPR015880 689 711 SM00355 Zinc finger

IPR015880 719 741 SM00355 Zinc finger

IPR015880 747 769 SM00355 Zinc finger

ProfileScan IPR001909 310 381 PS50805 KRAB box

IPR007087 571 598 PS50157 Zinc finger

IPR007087 599 621 PS50157 Zinc finger

IPR007087 661 688 PS50157 Zinc finger

IPR007087 689 716 PS50157 Zinc finger

IPR007087 719 746 PS50157 Zinc finger

IPR007087 747 774 PS50157 Zinc finger

ScanRegExp IPR007087 573 593 PS00028 Zinc finger

IPR007087 601 621 PS00028 Zinc finger

IPR007087 663 683 PS00028 Zinc finger

IPR007087 691 711 PS00028 Zinc finger

IPR007087 721 741 PS00028 Zinc finger

IPR007087 749 769 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	663	684	PD000003	Zinc finger
IPR007087	719	742	PD000003	Zinc finger
HMMPfam	IPR001909	310	350	PF01352	KRAB box
IPR007087	571	593	PF00096	Zinc finger
IPR007087	599	621	PF00096	Zinc finger
IPR007087	661	683	PF00096	Zinc finger
IPR007087	689	711	PF00096	Zinc finger
IPR007087	719	741	PF00096	Zinc finger
IPR007087	747	769	PF00096	Zinc finger
HMMSmart	IPR001909	310	370	SM00349	KRAB box
IPR015880	571	593	SM00355	Zinc finger
IPR015880	599	621	SM00355	Zinc finger
IPR015880	661	683	SM00355	Zinc finger
IPR015880	689	711	SM00355	Zinc finger
IPR015880	719	741	SM00355	Zinc finger
IPR015880	747	769	SM00355	Zinc finger
ProfileScan	IPR001909	310	381	PS50805	KRAB box
IPR007087	571	598	PS50157	Zinc finger
IPR007087	599	621	PS50157	Zinc finger
IPR007087	661	688	PS50157	Zinc finger
IPR007087	689	716	PS50157	Zinc finger
IPR007087	719	746	PS50157	Zinc finger
IPR007087	747	774	PS50157	Zinc finger
ScanRegExp	IPR007087	573	593	PS00028	Zinc finger
IPR007087	601	621	PS00028	Zinc finger
IPR007087	663	683	PS00028	Zinc finger
IPR007087	691	711	PS00028	Zinc finger
IPR007087	721	741	PS00028	Zinc finger
IPR007087	749	769	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCCGGCAGCAATGGAGAAGTT

Primer_r
: ACATGAGGTCTGGTTTGGAAA

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGAGTTCAGGCAGAGATGTCC
Primer_r	: AACCAGTACACAGAGCCGATG
PCR product length	: 207 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	14 bp
Genome contig ID	gi89161213r_148660048
PolyA signal sequence (None)	+--------+--------+----*----+---- TCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGC
Flanking genome sequence (228853 - 228804)	----+--------+--------+--------+--------+----* GTGAAACCCCGTCTCTACTAAAAATATAAAAATTTGCCGTGTGTGGTGGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	148760038	148788900	6	99.6	Terminal No-hit

Primer_f	: CCCGGCAGCAATGGAGAAGTT
Primer_r	: ACATGAGGTCTGGTTTGGAAA
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1285

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information