| HUGE |
Gene/Protein Characteristic Table for KIAA2003 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00968 |
|---|---|
| Accession No. : | AB095924 |
| Description : | Zinc finger protein 154. |
| HUGO Gene Name : | |
| Clone Name : | ah02593 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA2003
|
| Source : | Human brain (amygdala) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5687 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 4176 bp Genome contig ID gi42406306r_62800946 PolyA signal sequence
(None)
CTGAGTCATTTTTTAATTAGAATTTGCTGTATTCTFlanking genome sequence
(99601 - 99552)
AGATGTGGCTTATTGAATCTCTAACATTGTTTAACTTGTACACTAGATGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 r 62900547 62912348 4 99.1 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 460 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : TCAGAAGCAATGTGGGCAGAG | |
| : AGTGTGAGCAGCCTGTTGATG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 19 |
| : genbank | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
