HUGE

Gene/Protein Characteristic Table for KIAA1287

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB033113
Description :	Integrator complex subunit 2.
HUGO Gene Name :
Clone Name :	hh13365 [Vector Info]
Flexi ORF Clone :	pF1KA1287
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6110 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO NO

Warning for coding interruption:
NO NO

Integrity of 3' end

Length of 3'UTR 2190 bp

Genome contig ID gi51511734r_57197512
PolyA signal sequence
(TATAAA,-28)
+----*----+----*----+----*----+----
ATTGGTTTATAAACATTCATATTCTTTATCAAACG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACCTGTAGTTTTTGTGTTTCATTCCACTAGAGTTAACCTGAAGGGAACG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 57297512 57360106 25 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1209 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_511605	99.8	hypothetical pr...	Pan troglodytes
CAL38257	99.8	hypothetical pr...	synthetic construct
XP_001110216	99.4	similar to inte...	Macaca mulatta
EAW51434	100.0	integrator comp...	Homo sapiens
XP_001143420	99.9	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAATTTGCTCTGTAACCTTCG

Primer_r
: AGACAGATGTGCATAGATGGA

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	NO
Warning for coding interruption:	NO	NO

Length of 3'UTR	2190 bp
Genome contig ID	gi51511734r_57197512
PolyA signal sequence (TATAAA,-28)	+--------+--------+----*----+---- ATTGGTTTATAAACATTCATATTCTTTATCAAACG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCTGTAGTTTTTGTGTTTCATTCCACTAGAGTTAACCTGAAGGGAACG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	57297512	57360106	25	99.6	Perfect prediction

Primer_f	: CAATTTGCTCTGTAACCTTCG
Primer_r	: AGACAGATGTGCATAGATGGA
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1287

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information