HUGE |
Gene/Protein Characteristic Table for KIAA1289 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04273 |
---|---|
Accession No. : | AB033115 |
Description : | Baculoviral IAP repeat-containing protein 6. |
HUGO Gene Name : | |
Clone Name : | hh15326s2 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hh15326, former representative clones for KIAA1289 with hh15326s2. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 9078 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 690 bp Genome contig ID gi89161199f_32448025 PolyA signal sequence
(AATAAA,-32) +----*----+----*----+----*----+----
AAAAATAAATGAACATGATTTTATTCTATGCCAACFlanking genome sequence
(249143 - 249192) ----+----*----+----*----+----*----+----*----+----*
ATTTGGGCCTCTGAATGTATCTGTTATTTGAATTTAAGTATTTGAAAAGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 32548025 32697166 45 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2793 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCATCCATACAAGTGCAAGTC | |
: CTGAAGACCTCCTACATACAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 2 |
: GeneBridge 4 | |
: GGGGCTCACTGCTTTTGGTAC | |
: ACTTGCCATCATTCCTTCTAG | |
: 154(1.6k) bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |