HUGE

Gene/Protein Characteristic Table for KIAA1734

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01635
Accession No. :	AB051521
Description :	Ubiquitin-conjugating enzyme E2 O.
HUGO Gene Name :
Clone Name :	ph00331 [Vector Info]
Flexi ORF Clone :	pF1KSDA1734
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 5073 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1129 bp

Genome contig ID gi51511734r_71797491
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AAAAACTCAAAAGCAAAGATATTAACTCTTATTAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAGACAAAAAAAAAGCCAAAGCATGATGCGTCTTGTCAGCCTTAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 71897491 71960883 18 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1313 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001099166	99.0	similar to ubiq...	Macaca mulatta
BAG10135	100.0	ubiquitin-conju...	synthetic construct
Q9C0C9	99.8	Ubiquitin-conju...	Homo sapiens
EAW89399	99.8	ubiquitin-conju...	Homo sapiens
EAW89398	99.5	ubiquitin-conju...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033115	4.6e-11	31.8	KIAA1289

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000608 981 1098 PD000461 Ubiquitin-conjugating enzyme

HMMPfam IPR000608 978 1127 PF00179 Ubiquitin-conjugating enzyme

HMMSmart IPR000608 977 1134 SM00212 Ubiquitin-conjugating enzyme

ProfileScan IPR000608 977 1098 PS50127 Ubiquitin-conjugating enzyme

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000608	981	1098	PD000461	Ubiquitin-conjugating enzyme
HMMPfam	IPR000608	978	1127	PF00179	Ubiquitin-conjugating enzyme
HMMSmart	IPR000608	977	1134	SM00212	Ubiquitin-conjugating enzyme
ProfileScan	IPR000608	977	1098	PS50127	Ubiquitin-conjugating enzyme

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTACCGGAGCTTCTTACCTGA

Primer_r
: TACTTGTCCTCTGTGCACTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1129 bp
Genome contig ID	gi51511734r_71797491
PolyA signal sequence (None)	+--------+--------+----*----+---- AAAAACTCAAAAGCAAAGATATTAACTCTTATTAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAGACAAAAAAAAAGCCAAAGCATGATGCGTCTTGTCAGCCTTAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	71897491	71960883	18	99.5	Perfect prediction

Primer_f	: CTACCGGAGCTTCTTACCTGA
Primer_r	: TACTTGTCCTCTGTGCACTCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1734

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information