HUGE

Gene/Protein Characteristic Table for KIAA1296

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06943
Accession No. :	AB037717
Description :	Sorbin and SH3 domain-containing protein 1.
HUGO Gene Name :	sorbin and SH3 domain containing 1 (SORBS1)
Clone Name :	fg03576 [Vector Info]
Flexi ORF Clone :	pF1KA1296
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5796 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3286 bp

Genome contig ID gi89161187r_96961521
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
TATTATTTAATAAACTTTATTCAGAATTGCGTGGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATATGTTTGTTCTGGTCATTCATTGTTTCTTTCCTCCCTTTGCCAAGCTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 97061521 97240871 25 99.3 Terminal No-hit

Features of the protein sequence	Description

Length: 815 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI52464	100.0	Sorbin and SH3 ...	Homo sapiens
CAI14382	99.9	sorbin and SH3 ...	Homo sapiens
XP_001154533	99.1	sorbin and SH3 ...	Pan troglodytes
BAG62137	95.9	unnamed protein...	Homo sapiens
CAH90184	94.2	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018320	3.8e-30	59.0	KIAA0777
AB040927	0.00011	38.5	KIAA1494

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR003127 295 415 PD016158 Sorbin-like

IPR001452 579 629 PD000066 Src homology-3

IPR001452 653 705 PD000066 Src homology-3

IPR001452 759 810 PD000066 Src homology-3

FPrintScan IPR000108 494 513 PR00499 Neutrophil cytosol factor 2

IPR001452 577 587 PR00452 Src homology-3

IPR000108 579 599 PR00499 Neutrophil cytosol factor 2

IPR000108 599 615 PR00499 Neutrophil cytosol factor 2

IPR000108 615 628 PR00499 Neutrophil cytosol factor 2

IPR001452 771 786 PR00452 Src homology-3

IPR001452 801 813 PR00452 Src homology-3

HMMPfam IPR003127 278 323 PF02208 Sorbin-like

IPR001452 577 631 PF00018 Src homology-3

IPR001452 651 707 PF00018 Src homology-3

IPR001452 757 813 PF00018 Src homology-3

HMMSmart IPR003127 278 324 SM00459 Sorbin-like

IPR001452 577 632 SM00326 Src homology-3

IPR001452 651 708 SM00326 Src homology-3

IPR001452 757 814 SM00326 Src homology-3

ProfileScan IPR003127 277 334 PS50831 Sorbin-like

IPR001452 574 633 PS50002 Src homology-3

IPR001452 648 709 PS50002 Src homology-3

IPR001452 754 815 PS50002 Src homology-3

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR003127	295	415	PD016158	Sorbin-like
IPR001452	579	629	PD000066	Src homology-3
IPR001452	653	705	PD000066	Src homology-3
IPR001452	759	810	PD000066	Src homology-3
FPrintScan	IPR000108	494	513	PR00499	Neutrophil cytosol factor 2
IPR001452	577	587	PR00452	Src homology-3
IPR000108	579	599	PR00499	Neutrophil cytosol factor 2
IPR000108	599	615	PR00499	Neutrophil cytosol factor 2
IPR000108	615	628	PR00499	Neutrophil cytosol factor 2
IPR001452	771	786	PR00452	Src homology-3
IPR001452	801	813	PR00452	Src homology-3
HMMPfam	IPR003127	278	323	PF02208	Sorbin-like
IPR001452	577	631	PF00018	Src homology-3
IPR001452	651	707	PF00018	Src homology-3
IPR001452	757	813	PF00018	Src homology-3
HMMSmart	IPR003127	278	324	SM00459	Sorbin-like
IPR001452	577	632	SM00326	Src homology-3
IPR001452	651	708	SM00326	Src homology-3
IPR001452	757	814	SM00326	Src homology-3
ProfileScan	IPR003127	277	334	PS50831	Sorbin-like
IPR001452	574	633	PS50002	Src homology-3
IPR001452	648	709	PS50002	Src homology-3
IPR001452	754	815	PS50002	Src homology-3

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGGTGCTTCTTGATTAGTAGG

Primer_r
: ATACATAGGAAGGCGACGTGA

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3286 bp
Genome contig ID	gi89161187r_96961521
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TATTATTTAATAAACTTTATTCAGAATTGCGTGGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATATGTTTGTTCTGGTCATTCATTGTTTCTTTCCTCCCTTTGCCAAGCTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	97061521	97240871	25	99.3	Terminal No-hit

Primer_f	: GGGTGCTTCTTGATTAGTAGG
Primer_r	: ATACATAGGAAGGCGACGTGA
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1296

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information