HUGE

Gene/Protein Characteristic Table for KIAA1494

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06819
Accession No. :	AB040927
Description :	SH3 domain containing ring finger 1.
HUGO Gene Name :	SH3 domain containing ring finger 1 (SH3RF1)
Clone Name :	fj08673 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4182 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2265 bp

Genome contig ID gi89161207r_170151982
PolyA signal sequence
(ATTAAA,-27)
+----*----+----*----+----*----+----
GTTTCAAGATTAAAATTTGATGTTCAAACCTTTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGTCCCTTGTGTCAGTCCTTAAAATTTTGCTTTTTAAAAAAACAAAACA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 r 170251982 170294358 8 99.3 Terminal No-hit

Features of the protein sequence	Description

Length: 638 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q7Z6J0	4.7e-193	100.0	Putative E3 ubi...	Homo sapiens
AAH53671	5.4e-193	100.0	SH3RF1 protein ...	Homo sapiens
XP_001152752	2e-192	99.5	SH3 domain cont...	Pan troglodytes
Q5RBR0	3.6e-190	98.7	Putative E3 ubi...	Pongo abelii
XP_001082524	2.4e-189	98.1	similar to SH3 ...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 199 252 PD000066 Src homology-3

IPR001452 590 636 PD000066 Src homology-3

FPrintScan IPR001452 198 208 PR00452 Src homology-3

IPR001452 596 611 PR00452 Src homology-3

IPR001452 613 622 PR00452 Src homology-3

IPR001452 626 638 PR00452 Src homology-3

HMMPfam IPR001452 198 254 PF00018 Src homology-3

IPR001452 590 638 PF00018 Src homology-3

HMMSmart IPR001452 198 255 SM00326 Src homology-3

IPR001452 582 638 SM00326 Src homology-3

ProfileScan IPR001452 195 256 PS50002 Src homology-3

IPR001452 585 638 PS50002 Src homology-3

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	199	252	PD000066	Src homology-3
IPR001452	590	636	PD000066	Src homology-3
FPrintScan	IPR001452	198	208	PR00452	Src homology-3
IPR001452	596	611	PR00452	Src homology-3
IPR001452	613	622	PR00452	Src homology-3
IPR001452	626	638	PR00452	Src homology-3
HMMPfam	IPR001452	198	254	PF00018	Src homology-3
IPR001452	590	638	PF00018	Src homology-3
HMMSmart	IPR001452	198	255	SM00326	Src homology-3
IPR001452	582	638	SM00326	Src homology-3
ProfileScan	IPR001452	195	256	PS50002	Src homology-3
IPR001452	585	638	PS50002	Src homology-3

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCTTGGTGGGAGTGAATTTGC

Primer_r
: CTTATTCATTACCAGGCTGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2265 bp
Genome contig ID	gi89161207r_170151982
PolyA signal sequence (ATTAAA,-27)	+--------+--------+----*----+---- GTTTCAAGATTAAAATTTGATGTTCAAACCTTTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGTCCCTTGTGTCAGTCCTTAAAATTTTGCTTTTTAAAAAAACAAAACA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	r	170251982	170294358	8	99.3	Terminal No-hit

Primer_f	: GCTTGGTGGGAGTGAATTTGC
Primer_r	: CTTATTCATTACCAGGCTGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1494

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information