HUGE

Gene/Protein Characteristic Table for KIAA1300

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05650
Accession No. :	AB037721
Description :
HUGO Gene Name :	StAR-related lipid transfer (START) domain containing 9 (STARD9)
Clone Name :	fg06819 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 6747 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1283 bp

Genome contig ID gi51511731f_40669708
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGATTGAAGGTTTTTTAAAATTGCTTTTAAACTTC
Flanking genome sequence
(130641 - 130690)
----+----*----+----*----+----*----+----*----+----*
TATTTCTCGGGTAAATTTTTTGGTGACATGATATATTTAACACCCTATTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 f 40769708 40800347 11 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 1820 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2P6	99.8	StAR-related li...	Homo sapiens
XP_510339	97.8	START domain co...	Pan troglodytes
EAW92575	99.9	hCG1786640 [Hom...	Homo sapiens
XP_001105580	90.2	START domain co...	Macaca mulatta
XP_001500670	70.8	similar to StAR...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR002913 1685 1820 PS50848 Lipid-binding START

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR002913	1685	1820	PS50848	Lipid-binding START

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCATCTTTAGTTCTGGTGCCC

Primer_r
: AACACATCTCTGCCACACTAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTGCCAGATCAAAGACCAAGC
Primer_r	: TGAGAACTGCATGGCTGTCGG
PCR product length	: 182 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1283 bp
Genome contig ID	gi51511731f_40669708
PolyA signal sequence (None)	+--------+--------+----*----+---- TGATTGAAGGTTTTTTAAAATTGCTTTTAAACTTC
Flanking genome sequence (130641 - 130690)	----+--------+--------+--------+--------+----* TATTTCTCGGGTAAATTTTTTGGTGACATGATATATTTAACACCCTATTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	f	40769708	40800347	11	99.2	Perfect prediction

Primer_f	: TCATCTTTAGTTCTGGTGCCC
Primer_r	: AACACATCTCTGCCACACTAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1300

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information