Gene/Protein Characteristic Table for KIAA1308

Length: 5796 bp

Restriction map

Length of 3'UTR	3558 bp
Genome contig ID	gi89161216r_134862929
PolyA signal sequence (ATTAAA,-22)	+----*----+----*----+----*----+---- ACTTGAATATTATATTAAAATCCTGTTTCTACTAT
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* ACCCTGGTCATTACAGTTTTGTTCTTTCATTACCTGTCTTAATTAAAATG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	r	134962929	134974046	12	99.2	Perfect prediction

Length: 745 aa

Entry Exp ID% Protein Source EAW88039 0 100.0 ral guanine nuc... Homo sapiens EAW88041 0 100.0 ral guanine nuc... Homo sapiens BAB84940 1.5e-156 98.2 FLJ00185 protei... Homo sapiens EAW88037 1.5e-156 98.2 ral guanine nuc... Homo sapiens AAQ13414 1.5e-156 98.2 Ral guanine nuc... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% HUGE_ID AB023176 3.8e-27 53.6 KIAA0959

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001895	179	393	PF00617	Guanine-nucleotide dissociation stimulator CDC25
HMMSmart	IPR001895	178	445	SM00147	Guanine-nucleotide dissociation stimulator CDC25
ProfileScan	IPR001895	182	444	PS50009	Guanine-nucleotide dissociation stimulator CDC25
ScanRegExp	IPR001895	360	390	PS00720	Guanine-nucleotide dissociation stimulator CDC25

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-