HUGE

Gene/Protein Characteristic Table for KIAA0959

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01616
Accession No. :	AB023176
Description :	Ral guanine nucleotide dissociation stimulator-like 1.
HUGO Gene Name :
Clone Name :	hj05718 [Vector Info]
Flexi ORF Clone :	pF1KSDA0959
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4703 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2239 bp

Genome contig ID gi89161185f_181940898
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GGACTTGGCTGGCATGTGCTGCCAGACCCAAAGGG
Flanking genome sequence
(223392 - 223441)
----+----*----+----*----+----*----+----*----+----*
ATTGTATCTGGATTATTAACCAGGTGGGTTTTGGGTTCCAGTGTGTCAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 182040898 182164288 18 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 820 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NZL6	100.0	Ral guanine nuc...	Homo sapiens
AAG14400	99.9	RalGDS-like [Ho...	Homo sapiens
CAH73873	98.4	ral guanine nuc...	Homo sapiens
CAD97658	98.2	hypothetical pr...	Homo sapiens
AAG14401	98.3	RalGDS-like [Ho...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037729	2.8e-50	53.6	KIAA1308
AB002349	1.4e-08	29.8	KIAA0351
AB002311	2.5e-05	22.9	KIAA0313
AB020653	0.00058	26.7	KIAA0846

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000651 120 226 PF00618 Guanine nucleotide exchange factor for Ras-like GTPases

IPR001895 281 502 PF00617 Guanine-nucleotide dissociation stimulator CDC25

IPR000159 700 787 PF00788 Ras-association

HMMSmart IPR000651 116 248 SM00229 Guanine nucleotide exchange factor for Ras-like GTPases

IPR001895 280 554 SM00147 Guanine-nucleotide dissociation stimulator CDC25

IPR000159 700 787 SM00314 Ras-association

ProfileScan IPR000651 117 248 PS50212 Guanine nucleotide exchange factor for Ras-like GTPases

IPR001895 284 553 PS50009 Guanine-nucleotide dissociation stimulator CDC25

IPR000159 700 787 PS50200 Ras-association

ScanRegExp IPR001895 469 499 PS00720 Guanine-nucleotide dissociation stimulator CDC25

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000651	120	226	PF00618	Guanine nucleotide exchange factor for Ras-like GTPases
IPR001895	281	502	PF00617	Guanine-nucleotide dissociation stimulator CDC25
IPR000159	700	787	PF00788	Ras-association
HMMSmart	IPR000651	116	248	SM00229	Guanine nucleotide exchange factor for Ras-like GTPases
IPR001895	280	554	SM00147	Guanine-nucleotide dissociation stimulator CDC25
IPR000159	700	787	SM00314	Ras-association
ProfileScan	IPR000651	117	248	PS50212	Guanine nucleotide exchange factor for Ras-like GTPases
IPR001895	284	553	PS50009	Guanine-nucleotide dissociation stimulator CDC25
IPR000159	700	787	PS50200	Ras-association
ScanRegExp	IPR001895	469	499	PS00720	Guanine-nucleotide dissociation stimulator CDC25

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAGGTTGAAGTATATGTAGCC

Primer_r
: ACACAGGATGAACACGGGCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2239 bp
Genome contig ID	gi89161185f_181940898
PolyA signal sequence (None)	+--------+--------+----*----+---- GGACTTGGCTGGCATGTGCTGCCAGACCCAAAGGG
Flanking genome sequence (223392 - 223441)	----+--------+--------+--------+--------+----* ATTGTATCTGGATTATTAACCAGGTGGGTTTTGGGTTCCAGTGTGTCAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	182040898	182164288	18	100.0	Perfect prediction

Primer_f	: CAGGTTGAAGTATATGTAGCC
Primer_r	: ACACAGGATGAACACGGGCAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0959

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information