HUGE

Gene/Protein Characteristic Table for KIAA0846

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00656
Accession No. :	AB020653
Description :	RAS guanyl-releasing protein 3.
HUGO Gene Name :	RAS guanyl releasing protein 3 (calcium and DAG-regulated) (RASGRP3)
Clone Name :	hk05386 [Vector Info]
Flexi ORF Clone :	pF1KSDA0846
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4204 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1862 bp

Genome contig ID gi89161199f_33492446
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AATAAACATTGTACTGTTCTTTTGCTTCTCAAAGG
Flanking genome sequence
(150732 - 150781)
----+----*----+----*----+----*----+----*----+----*
AATTATTCACTTGCCACTTTGGTTATTTTTGAGTTTTCGTACATAGGAAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 33592446 33643176 17 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 691 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX00432	100.0	RAS guanyl rele...	Homo sapiens
Q8IV61	99.9	Ras guanyl-rele...	Homo sapiens
XP_001165459	99.9	RAS guanyl rele...	Pan troglodytes
BAF85672	99.6	unnamed protein...	Homo sapiens
XP_525730	99.7	RAS guanyl rele...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002349	8.8e-11	29.2	KIAA0351
D87467	2.3e-08	26.5	KIAA0277
AB028955	4e-08	47.7	KIAA1032
AB002311	2.5e-06	23.0	KIAA0313
AB023176	1.6e-05	27.0	KIAA0959

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002219 493 507 PR00008 Protein kinase C

IPR002219 509 518 PR00008 Protein kinase C

IPR002219 522 533 PR00008 Protein kinase C

IPR002219 534 546 PR00008 Protein kinase C

HMMPfam IPR000651 2 104 PF00618 Guanine nucleotide exchange factor for Ras-like GTPases

IPR001895 148 334 PF00617 Guanine-nucleotide dissociation stimulator CDC25

IPR002048 425 453 PF00036 Calcium-binding EF-hand

IPR002048 454 482 PF00036 Calcium-binding EF-hand

IPR002219 496 548 PF00130 Protein kinase C

HMMSmart IPR000651 4 127 SM00229 Guanine nucleotide exchange factor for Ras-like GTPases

IPR001895 150 386 SM00147 Guanine-nucleotide dissociation stimulator CDC25

IPR002048 425 453 SM00054 Calcium-binding EF-hand

IPR002048 454 482 SM00054 Calcium-binding EF-hand

IPR002219 496 545 SM00109 Protein kinase C

ProfileScan IPR000651 5 127 PS50212 Guanine nucleotide exchange factor for Ras-like GTPases

IPR001895 154 385 PS50009 Guanine-nucleotide dissociation stimulator CDC25

IPR002048 421 456 PS50222 Calcium-binding EF-hand

IPR002048 459 485 PS50222 Calcium-binding EF-hand

IPR002219 495 545 PS50081 Protein kinase C

ScanRegExp IPR002048 434 446 PS00018 Calcium-binding EF-hand

IPR002048 463 475 PS00018 Calcium-binding EF-hand

IPR002219 496 545 PS00479 Protein kinase C

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002219	493	507	PR00008	Protein kinase C
IPR002219	509	518	PR00008	Protein kinase C
IPR002219	522	533	PR00008	Protein kinase C
IPR002219	534	546	PR00008	Protein kinase C
HMMPfam	IPR000651	2	104	PF00618	Guanine nucleotide exchange factor for Ras-like GTPases
IPR001895	148	334	PF00617	Guanine-nucleotide dissociation stimulator CDC25
IPR002048	425	453	PF00036	Calcium-binding EF-hand
IPR002048	454	482	PF00036	Calcium-binding EF-hand
IPR002219	496	548	PF00130	Protein kinase C
HMMSmart	IPR000651	4	127	SM00229	Guanine nucleotide exchange factor for Ras-like GTPases
IPR001895	150	386	SM00147	Guanine-nucleotide dissociation stimulator CDC25
IPR002048	425	453	SM00054	Calcium-binding EF-hand
IPR002048	454	482	SM00054	Calcium-binding EF-hand
IPR002219	496	545	SM00109	Protein kinase C
ProfileScan	IPR000651	5	127	PS50212	Guanine nucleotide exchange factor for Ras-like GTPases
IPR001895	154	385	PS50009	Guanine-nucleotide dissociation stimulator CDC25
IPR002048	421	456	PS50222	Calcium-binding EF-hand
IPR002048	459	485	PS50222	Calcium-binding EF-hand
IPR002219	495	545	PS50081	Protein kinase C
ScanRegExp	IPR002048	434	446	PS00018	Calcium-binding EF-hand
IPR002048	463	475	PS00018	Calcium-binding EF-hand
IPR002219	496	545	PS00479	Protein kinase C

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTGCCAACCAGATTTACAGAT

Primer_r
: CACGTTCTCTTATTATCCAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1862 bp
Genome contig ID	gi89161199f_33492446
PolyA signal sequence (None)	+--------+--------+----*----+---- AATAAACATTGTACTGTTCTTTTGCTTCTCAAAGG
Flanking genome sequence (150732 - 150781)	----+--------+--------+--------+--------+----* AATTATTCACTTGCCACTTTGGTTATTTTTGAGTTTTCGTACATAGGAAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	33592446	33643176	17	99.6	Perfect prediction

Primer_f	: GTGCCAACCAGATTTACAGAT
Primer_r	: CACGTTCTCTTATTATCCAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0846

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information