HUGE |
Gene/Protein Characteristic Table for KIAA0351 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00057 |
---|---|
Accession No. : | AB002349 |
Description : | Ral GEF with PH domain and SH3 binding motif 1. |
HUGO Gene Name : | Ral GEF with PH domain and SH3 binding motif 2 (RALGPS2) |
Clone Name : | hg01609 [Vector Info] |
Flexi ORF Clone : | pF1KA0351
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6336 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 4395 bp Genome contig ID gi89161216f_128616874 PolyA signal sequence
(ATTAAA,-20) +----*----+----*----+----*----+----
TTTGTTTACTTTGAAATTAAATGTGTTTTCCAATGFlanking genome sequence
(408392 - 408441) ----+----*----+----*----+----*----+----*----+----*
AATGTTGCTCAGTTTATTAAAGTCACACACATTCACTTAGCAAACAGTTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 9 f 128716874 129025264 19 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 590 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: TTACTGCGGGTGAGACGATTC | |
: ATCTGTTGCACTCTCCTGGGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 9 |
: GeneBridge 4 | |
: TTACTGCGGGTGAGACGATTC | |
: ATCTGTTGCACTCTCCTGGGC | |
: 102 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |