HUGE

Gene/Protein Characteristic Table for KIAA0351

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00057
Accession No. :	AB002349
Description :	Ral GEF with PH domain and SH3 binding motif 1.
HUGO Gene Name :	Ral GEF with PH domain and SH3 binding motif 2 (RALGPS2)
Clone Name :	hg01609 [Vector Info]
Flexi ORF Clone :	pF1KA0351
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6336 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4395 bp

Genome contig ID gi89161216f_128616874
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
TTTGTTTACTTTGAAATTAAATGTGTTTTCCAATG
Flanking genome sequence
(408392 - 408441)
----+----*----+----*----+----*----+----*----+----*
AATGTTGCTCAGTTTATTAAAGTCACACACATTCACTTAGCAAACAGTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 128716874 129025264 19 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 590 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001096712	0	98.8	similar to Ral ...	Macaca mulatta
Q5JS13	0	100.0	Ras-specific gu...	Homo sapiens
XP_873225	0	98.2	similar to Ral ...	Bos taurus
XP_001366247	2e-210	93.8	similar to Ral ...	Monodelphis dom...
XP_851594	5.7e-170	93.2	similar to Ral ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87467	1.5e-10	27.1	KIAA0277
AB023176	5.3e-10	29.8	KIAA0959
AB037729	6.3e-10	26.2	KIAA1308
AB020653	1.3e-09	28.8	KIAA0846
AB002311	3.1e-09	27.2	KIAA0313

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001895 80 271 PF00617 Guanine-nucleotide dissociation stimulator CDC25

IPR001849 465 576 PF00169 Pleckstrin-like

HMMSmart IPR001895 79 323 SM00147 Guanine-nucleotide dissociation stimulator CDC25

IPR001849 465 578 SM00233 Pleckstrin-like

ProfileScan IPR001895 83 322 PS50009 Guanine-nucleotide dissociation stimulator CDC25

IPR001849 464 576 PS50003 Pleckstrin-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001895	80	271	PF00617	Guanine-nucleotide dissociation stimulator CDC25
IPR001849	465	576	PF00169	Pleckstrin-like
HMMSmart	IPR001895	79	323	SM00147	Guanine-nucleotide dissociation stimulator CDC25
IPR001849	465	578	SM00233	Pleckstrin-like
ProfileScan	IPR001895	83	322	PS50009	Guanine-nucleotide dissociation stimulator CDC25
IPR001849	464	576	PS50003	Pleckstrin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TTACTGCGGGTGAGACGATTC

Primer_r
: ATCTGTTGCACTCTCCTGGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTACTGCGGGTGAGACGATTC
Primer_r	: ATCTGTTGCACTCTCCTGGGC
PCR product length	: 102 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4395 bp
Genome contig ID	gi89161216f_128616874
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TTTGTTTACTTTGAAATTAAATGTGTTTTCCAATG
Flanking genome sequence (408392 - 408441)	----+--------+--------+--------+--------+----* AATGTTGCTCAGTTTATTAAAGTCACACACATTCACTTAGCAAACAGTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	128716874	129025264	19	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0351

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information