HUGE

Gene/Protein Characteristic Table for KIAA0277

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00490
Accession No. :	D87467
Description :	Rap guanine nucleotide exchange factor (GEF) 5.
HUGO Gene Name :	Rap guanine nucleotide exchange factor (GEF) 5 (RAPGEF5)
Clone Name :	ha06833 [Vector Info]
Flexi ORF Clone :	pF1KSDA0277
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5900 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4102 bp

Genome contig ID gi89161213r_22024447
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGCTTTTCCAAATATGAGACTATGTTAAAGACACT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTCATGCCTCTTAGTTTCTTGCTTTCTCTGTGATGTGTGTGGATTAAAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 22124447 22199859 16 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 583 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92565	100.0	Rap guanine nuc...	Homo sapiens
EAW93745	98.6	hCG38228, isofo...	Homo sapiens
XP_539466	97.2	similar to Rap ...	Canis lupus fam...
P83900	95.3	Rap guanine nuc...	Rattus norvegicus
AAH46627	94.8	Rapgef5 protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002311	3.2e-26	29.3	KIAA0313
AB002349	5.2e-12	27.1	KIAA0351
AB020653	1.5e-08	26.5	KIAA0846
AB023176	2.9e-05	27.9	KIAA0959

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000651 74 178 PF00618 Guanine nucleotide exchange factor for Ras-like GTPases

IPR001895 345 529 PF00617 Guanine-nucleotide dissociation stimulator CDC25

HMMSmart IPR000651 70 204 SM00229 Guanine nucleotide exchange factor for Ras-like GTPases

IPR001895 344 583 SM00147 Guanine-nucleotide dissociation stimulator CDC25

ProfileScan IPR000651 71 204 PS50212 Guanine nucleotide exchange factor for Ras-like GTPases

IPR001895 348 582 PS50009 Guanine-nucleotide dissociation stimulator CDC25

ScanRegExp IPR001895 497 526 PS00720 Guanine-nucleotide dissociation stimulator CDC25

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000651	74	178	PF00618	Guanine nucleotide exchange factor for Ras-like GTPases
IPR001895	345	529	PF00617	Guanine-nucleotide dissociation stimulator CDC25
HMMSmart	IPR000651	70	204	SM00229	Guanine nucleotide exchange factor for Ras-like GTPases
IPR001895	344	583	SM00147	Guanine-nucleotide dissociation stimulator CDC25
ProfileScan	IPR000651	71	204	PS50212	Guanine nucleotide exchange factor for Ras-like GTPases
IPR001895	348	582	PS50009	Guanine-nucleotide dissociation stimulator CDC25
ScanRegExp	IPR001895	497	526	PS00720	Guanine-nucleotide dissociation stimulator CDC25

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: AGCCCTGCGAGTCTGTTCTAG
Primer_r	: TGTTGGACCACTGCGGAAGAC
PCR product length	: 144 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4102 bp
Genome contig ID	gi89161213r_22024447
PolyA signal sequence (None)	+--------+--------+----*----+---- TGCTTTTCCAAATATGAGACTATGTTAAAGACACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCATGCCTCTTAGTTTCTTGCTTTCTCTGTGATGTGTGTGGATTAAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	22124447	22199859	16	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0277

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information