HUGE

Gene/Protein Characteristic Table for KIAA1310

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00212
Accession No. :	AB037731
Description :	K1310_HUMAN Isoform 4 of Q9P2N6 - Homo sapiens.
HUGO Gene Name :
Clone Name :	fh10589 [Vector Info]
Flexi ORF Clone :	pF1KA1310
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5028 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2586 bp

Genome contig ID gi89161199r_96522638
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
TTACATTAACAAAAACAATTAAAAACACCAAAAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACATTTGGATTGCTTCAGCTTCTTTTCAGTTGACTTCTCATATGTATTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 96622638 96667795 21 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 794 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001150109	1.4e-207	96.0	similar to FLJ1...	Pan troglodytes
XP_851544	2.6e-207	93.8	similar to CG82...	Canis lupus fam...
XP_515632	2.1e-206	96.7	similar to FLJ1...	Pan troglodytes
XP_001149512	2.1e-206	96.7	similar to FLJ1...	Pan troglodytes
CAL37956	6.5e-206	96.5	hypothetical pr...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AACTTGCACAGGGTAACAGAG

Primer_r
: ACATCTCCATAGGGCATCAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2586 bp
Genome contig ID	gi89161199r_96522638
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- TTACATTAACAAAAACAATTAAAAACACCAAAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACATTTGGATTGCTTCAGCTTCTTTTCAGTTGACTTCTCATATGTATTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	96622638	96667795	21	100.0	Perfect prediction

Primer_f	: AACTTGCACAGGGTAACAGAG
Primer_r	: ACATCTCCATAGGGCATCAAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1310

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information