HUGE

Gene/Protein Characteristic Table for KIAA1317

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00800
Accession No. :	AB037738
Description :	BTB/POZ domain-containing protein KCTD16.
HUGO Gene Name :	potassium channel tetramerisation domain containing 16 (KCTD16)
Clone Name :	fh13117 [Vector Info]
Flexi ORF Clone :	pF1KSDA1317
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5646 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3268 bp

Genome contig ID gi51511721f_143465033
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
GTGAATTAAAATAAAAGGGGGAACAATGCACAAAT
Flanking genome sequence
(372106 - 372155)
----+----*----+----*----+----*----+----*----+----*
AATAAGCGTTCCCTTTGCTCTTTATTCCTTTATAGTTGTATCTATTCCAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 143565033 143837137 3 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 435 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q68DU8	2.1e-178	100.0	BTB/POZ domain-...	Homo sapiens
BAF85166	1e-177	99.8	unnamed protein...	Homo sapiens
XP_001098121	1.4e-177	99.3	similar to pota...	Macaca mulatta
XP_001917937	3.5e-176	98.1	potassium chann...	Equus caballus
XP_544324	2e-175	97.7	similar to pota...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AF359381	9.5e-29	56.0	KIAA1778
D79998	2.8e-06	30.1	KIAA0176

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003131 34 129 PF02214 K+ channel tetramerisation

HMMSmart IPR000210 32 137 SM00225 BTB/POZ-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003131	34	129	PF02214	K+ channel tetramerisation
HMMSmart	IPR000210	32	137	SM00225	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGTGTAGAGCCCCAACTTAG

Primer_r
: GACAACCCACATACCTTTAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATGTGTAGAGCCCCAACTTAG
Primer_r	: GACAACCCACATACCTTTAGG
PCR product length	: 99 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3268 bp
Genome contig ID	gi51511721f_143465033
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- GTGAATTAAAATAAAAGGGGGAACAATGCACAAAT
Flanking genome sequence (372106 - 372155)	----+--------+--------+--------+--------+----* AATAAGCGTTCCCTTTGCTCTTTATTCCTTTATAGTTGTATCTATTCCAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	143565033	143837137	3	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA1317

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information