HUGE

Gene/Protein Characteristic Table for KIAA1778

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00914
Accession No. :	AF359381
Description :	BTB/POZ domain-containing protein KCTD12.
HUGO Gene Name :	potassium channel tetramerisation domain containing 12 (KCTD12)
Clone Name :	pg00707 [Vector Info]
Flexi ORF Clone :	pF1KSDA1778
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 6216 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 4996 bp

Genome contig ID gi51511729r_76252313
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
AATTAAACACTAAAGAATAAAACATTCACTCCTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTATTCCTCTTGGCTCCTTGGCATGGATTGGCTTGAACACTGGTCTAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 r 76352313 76358526 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 341 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96CX2	3.5e-117	100.0	BTB/POZ domain-...	Homo sapiens
XP_001085454	5.9e-117	99.7	similar to pota...	Macaca mulatta
XP_344451	7.3e-117	97.0	similar to Pota...	Rattus norvegicus
XP_001076656	7.4e-117	97.0	similar to Pota...	Rattus norvegicus
XP_542614	9.4e-117	96.7	similar to Pota...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037738	2.1e-19	56.3	KIAA1317

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003131 52 145 PF02214 K+ channel tetramerisation

HMMSmart IPR000210 50 153 SM00225 BTB/POZ-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003131	52	145	PF02214	K+ channel tetramerisation
HMMSmart	IPR000210	50	153	SM00225	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
:

Primer_r
:

PCR conditions
: °C sec °C sec cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	4996 bp
Genome contig ID	gi51511729r_76252313
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AATTAAACACTAAAGAATAAAACATTCACTCCTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTATTCCTCTTGGCTCCTTGGCATGGATTGGCTTGAACACTGGTCTAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	r	76352313	76358526	1	99.0	Perfect prediction

Primer_f	:
Primer_r	:
PCR conditions	: °C sec °C sec cycles

Gene/Protein Characteristic Table for KIAA1778

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information