HUGE |
Gene/Protein Characteristic Table for KIAA1328 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00804 |
---|---|
Accession No. : | AB037749 |
Description : | |
HUGO Gene Name : | |
Clone Name : | fh14746s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1328
![]() |
Source : | Human fetal brain |
Note : | We replaced fh14746, former representative clones for KIAA1328 with fh14746s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5520 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Content-type: text/html ¥¨¥é¡¼¡ª
fh14746s1 ¤Î¾ðÊ󤬥ǡ¼¥¿¥Ù¡¼¥¹¤Ë¤¢¤ê¤Þ¤»¤ó¤Ç¤·¤¿¡£
¤â¤É¤ë
Features of the protein sequence |
Description | |
---|---|---|
Length: 585 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GGCACCAAGTTCATAATAGAG | |
: CTGAGCTGAGGATAAATCGTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 18 |
: GeneBridge 4 | |
: GGCACCAAGTTCATAATAGAG | |
: CTGAGCTGAGGATAAATCGTG | |
: 141 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |