HUGE

Gene/Protein Characteristic Table for KIAA1328

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00804
Accession No. :	AB037749
Description :
HUGO Gene Name :
Clone Name :	fh14746s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1328
Source :	Human fetal brain
Note :	We replaced fh14746, former representative clones for KIAA1328 with fh14746s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5520 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO
Ensembl ContigView (Add our DAS server as a DAS source)
Content-type: text/html ¥¨¥é¡¼¡ª

fh14746s1 ¤Î¾ðÊó¤¬¥Ç¡¼¥¿¥Ù¡¼¥¹¤Ë¤¢¤ê¤Þ¤»¤ó¤Ç¤·¤¿¡£

¤â¤É¤ë

Features of the protein sequence	Description

Length: 585 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAF84977	6.9e-196	99.8	unnamed protein...	Homo sapiens
XP_001139184	1.1e-191	98.4	hypothetical pr...	Pan troglodytes
XP_001106820	2.8e-182	94.1	hypothetical pr...	Macaca mulatta
BAB46887	1.6e-167	94.0	hypothetical pr...	Macaca fascicularis
BAG65099	1.2e-152	96.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGCACCAAGTTCATAATAGAG

Primer_r
: CTGAGCTGAGGATAAATCGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 18

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGCACCAAGTTCATAATAGAG
Primer_r	: CTGAGCTGAGGATAAATCGTG
PCR product length	: 141 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA1328

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information