HUGE

Gene/Protein Characteristic Table for KIAA1332

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05002
Accession No. :	AB037753
Description :	F-box only protein 42.
HUGO Gene Name :	F-box protein 42 (FBXO42)
Clone Name :	fh15405 [Vector Info]
Flexi ORF Clone :	pF1KA1332
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5788 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3831 bp

Genome contig ID gi89161185r_16345921
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
GCAATTTAACAAATAAAATGGACAATTGTCTTAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TGTTTTATTAGCAAAAAAAGAAAAAGAAAAGAGGTCTGGCCGGGCGCAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 16445921 16514303 9 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 651 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6P3S6	100.0	F-box only prot...	Homo sapiens
BAG51542	99.8	unnamed protein...	Homo sapiens
AAH43410	99.8	F-box protein 4...	Homo sapiens
Q5RDA9	99.4	F-box only prot...	Pongo abelii
XP_001086461	99.4	F-box protein 4...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011498 52 102 PF07646 Kelch repeat type 2

IPR006652 107 161 PF01344 Kelch repeat type 1

IPR011498 165 211 PF07646 Kelch repeat type 2

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011498	52	102	PF07646	Kelch repeat type 2
IPR006652	107	161	PF01344	Kelch repeat type 1
IPR011498	165	211	PF07646	Kelch repeat type 2

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTCACAGGTTATACAGCAGAG

Primer_r
: TCAAATCAATCCACAGACAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3831 bp
Genome contig ID	gi89161185r_16345921
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GCAATTTAACAAATAAAATGGACAATTGTCTTAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGTTTTATTAGCAAAAAAAGAAAAAGAAAAGAGGTCTGGCCGGGCGCAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	16445921	16514303	9	100.0	Perfect prediction

Primer_f	: TTCACAGGTTATACAGCAGAG
Primer_r	: TCAAATCAATCCACAGACAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1332

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information