HUGE

Gene/Protein Characteristic Table for KIAA1350

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00812
Accession No. :	AB037771
Description :	Inactive ubiquitin carboxyl-terminal hydrolase 53.
HUGO Gene Name :	ubiquitin specific peptidase 53 (USP53)
Clone Name :	fj00953 [Vector Info]
Flexi ORF Clone :	pF1KSDA1350
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4153 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1416 bp

Genome contig ID gi89161207f_120297043
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
TGGATAAACCTCATATTCAATAAACTAGTAAATGT
Flanking genome sequence
(138190 - 138239)
----+----*----+----*----+----*----+----*----+----*
AGCCACTTGACTGATTGCGTAAATCGTGTTAAAACATTCTAAAATGTTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 f 120397043 120435231 11 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 911 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q70EK8	99.9	Inactive ubiqui...	Homo sapiens
CAE47751	99.8	ubiquitin speci...	Homo sapiens
CAH18315	99.6	hypothetical pr...	Homo sapiens
XP_517410	99.0	ubiquitin speci...	Pan troglodytes
XP_001098826	95.6	similar to ubiq...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTCAACTAACGATTTTCAGGC

Primer_r
: TGTATCCGTCATGCAGCTATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTCAACTAACGATTTTCAGGC
Primer_r	: TGTATCCGTCATGCAGCTATC
PCR product length	: 139 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1416 bp
Genome contig ID	gi89161207f_120297043
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TGGATAAACCTCATATTCAATAAACTAGTAAATGT
Flanking genome sequence (138190 - 138239)	----+--------+--------+--------+--------+----* AGCCACTTGACTGATTGCGTAAATCGTGTTAAAACATTCTAAAATGTTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	120397043	120435231	11	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1350

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information