HUGE |
Gene/Protein Characteristic Table for KIAA1373 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00221 |
---|---|
Accession No. : | AB037794 |
Description : | AMSH-like protease. |
HUGO Gene Name : | STAM binding protein-like 1 (STAMBPL1) |
Clone Name : | fj03723 [Vector Info] |
Flexi ORF Clone : | pF1KA1373
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4052 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1840 bp Genome contig ID gi89161187f_90529603 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GAAGTGAAAGTGAAACCAGAATGCTGTCAACGATTFlanking genome sequence
(195289 - 195338) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAACTCTCAAGCAAGAGCAAACAATGATACTGCCTCTAC
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 f 90629603 90724890 11 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 463 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CGGTGAAATTGATGGTGGAGC | |
: GCAGAAAAAGCTCGCAGGTGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 10 |
: GeneBridge 4 | |
: CGGTGAAATTGATGGTGGAGC | |
: GCAGAAAAAGCTCGCAGGTGG | |
: 159 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |