HUGE |
Gene/Protein Characteristic Table for KIAA1374 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05494 |
---|---|
Accession No. : | AB037795 |
Description : | Intraflagellar transport 80 homolog. |
HUGO Gene Name : | intraflagellar transport 80 homolog (Chlamydomonas) (IFT80) |
Clone Name : | fj04345 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4044 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1533 bp Genome contig ID gi89161205r_161357545 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
CACAATAAATGCAAAAAATAAAAAGTCTGTGTTCTFlanking genome sequence
(99929 - 99880) ----+----*----+----*----+----*----+----*----+----*
AAACAATTCTCTCATATCCTAGAATTCAATCCAATTCTAACACTAACTAC
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 r 161457474 161584138 19 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 764 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCATCAGAACTAGGAAAGCAC | |
: TCTTCAGCAGTAGTCCAGCCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 3 |
: GeneBridge 4 | |
: AGGGCGCTTTATTTCATCTCC | |
: TTCCATCACCTAACGGCTTTC | |
: 164(800) bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |