HUGE

Gene/Protein Characteristic Table for KIAA1374

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05494
Accession No. :	AB037795
Description :	Intraflagellar transport 80 homolog.
HUGO Gene Name :	intraflagellar transport 80 homolog (Chlamydomonas) (IFT80)
Clone Name :	fj04345 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4044 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1533 bp

Genome contig ID gi89161205r_161357545
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
CACAATAAATGCAAAAAATAAAAAGTCTGTGTTCT
Flanking genome sequence
(99929 - 99880)
----+----*----+----*----+----*----+----*----+----*
AAACAATTCTCTCATATCCTAGAATTCAATCCAATTCTAACACTAACTAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 161457474 161584138 19 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 764 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2H3	100.0	Intraflagellar ...	Homo sapiens
AAI01495	100.0	Intraflagellar ...	Homo sapiens
XP_001093524	97.5	similar to WD r...	Macaca mulatta
XP_545256	96.6	similar to WD r...	Canis lupus fam...
AAI42311	95.9	IFT80 protein [...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075822	8.8e-06	25.1	KIAA1942
AB046858	0.00053	20.6	KIAA1638
AB033087	0.00084	26.6	KIAA1261

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001680 15 29 PR00320 WD40 repeat

IPR001680 108 122 PR00320 WD40 repeat

IPR001680 190 204 PR00320 WD40 repeat

HMMPfam IPR001680 83 121 PF00400 WD40 repeat

IPR001680 165 203 PF00400 WD40 repeat

IPR001680 206 243 PF00400 WD40 repeat

HMMSmart IPR001680 82 121 SM00320 WD40 repeat

IPR001680 123 163 SM00320 WD40 repeat

IPR001680 164 203 SM00320 WD40 repeat

IPR001680 205 243 SM00320 WD40 repeat

IPR001680 245 284 SM00320 WD40 repeat

IPR001680 483 520 SM00320 WD40 repeat

ProfileScan IPR001680 89 121 PS50082 WD40 repeat

IPR001680 89 212 PS50294 WD40 repeat

IPR001680 171 203 PS50082 WD40 repeat

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001680	15	29	PR00320	WD40 repeat
IPR001680	108	122	PR00320	WD40 repeat
IPR001680	190	204	PR00320	WD40 repeat
HMMPfam	IPR001680	83	121	PF00400	WD40 repeat
IPR001680	165	203	PF00400	WD40 repeat
IPR001680	206	243	PF00400	WD40 repeat
HMMSmart	IPR001680	82	121	SM00320	WD40 repeat
IPR001680	123	163	SM00320	WD40 repeat
IPR001680	164	203	SM00320	WD40 repeat
IPR001680	205	243	SM00320	WD40 repeat
IPR001680	245	284	SM00320	WD40 repeat
IPR001680	483	520	SM00320	WD40 repeat
ProfileScan	IPR001680	89	121	PS50082	WD40 repeat
IPR001680	89	212	PS50294	WD40 repeat
IPR001680	171	203	PS50082	WD40 repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCATCAGAACTAGGAAAGCAC

Primer_r
: TCTTCAGCAGTAGTCCAGCCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGGGCGCTTTATTTCATCTCC
Primer_r	: TTCCATCACCTAACGGCTTTC
PCR product length	: 164(800) bp
PCR conditions	: 95 °C15 sec62 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1533 bp
Genome contig ID	gi89161205r_161357545
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CACAATAAATGCAAAAAATAAAAAGTCTGTGTTCT
Flanking genome sequence (99929 - 99880)	----+--------+--------+--------+--------+----* AAACAATTCTCTCATATCCTAGAATTCAATCCAATTCTAACACTAACTAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	161457474	161584138	19	100.0	Perfect prediction

Primer_f	: TCATCAGAACTAGGAAAGCAC
Primer_r	: TCTTCAGCAGTAGTCCAGCCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1374

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information