HUGE

Gene/Protein Characteristic Table for KIAA1638

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07350
Accession No. :	AB046858
Description :	WD repeat protein 19.
HUGO Gene Name :	WD repeat domain 19 (WDR19)
Clone Name :	fj04819s1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fj04819, former representative clones for KIAA1638 with fj04819s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 3095 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 377 bp

Genome contig ID gi89161207f_38793897
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCCTGGGCAACAGAGTGAGACCCCATCTC
Flanking genome sequence
(159459 - 159508)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAGATGGGCATATCAATTAGGATTGTATTTAGCTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 f 38893897 38953354 23 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 905 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG57877	100.0	unnamed protein...	Homo sapiens
EAW92917	100.0	WD repeat domai...	Homo sapiens
Q8NEZ3	100.0	WD repeat-conta...	Homo sapiens
AAK38745	100.0	WD repeat membr...	Homo sapiens
XP_517152	99.8	WD repeat domai...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033005	3.4e-08	22.0	KIAA1179
AB037795	9.5e-05	20.6	KIAA1374
AB011162	0.00019	22.3	KIAA0590

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000547 568 636 PF00637 Clathrin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000547	568	636	PF00637	Clathrin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGCTCACTTCATGTTTTCCTG

Primer_r
: AGAAACTGTGATTGGTAGCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: CCR
Primer_f	: CAGTGGCAAAGTGTAATCCGC
Primer_r	: GCTTCATTGTTGCATTTGGAC
PCR product length	: 182 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	377 bp
Genome contig ID	gi89161207f_38793897
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGCAACAGAGTGAGACCCCATCTC
Flanking genome sequence (159459 - 159508)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAGATGGGCATATCAATTAGGATTGTATTTAGCTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	38893897	38953354	23	100.0	Perfect prediction

Primer_f	: GGCTCACTTCATGTTTTCCTG
Primer_r	: AGAAACTGTGATTGGTAGCTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1638

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information