HUGE

Gene/Protein Characteristic Table for KIAA1399

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00826
Accession No. :	AB037820
Description :	E3 ubiquitin-protein ligase MARCH4 precursor.
HUGO Gene Name :	membrane-associated ring finger (C3HC4) 4 (MARCH4)
Clone Name :	hk07377 [Vector Info]
Flexi ORF Clone :	pF1KSDA1399
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4450 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1450 bp

Genome contig ID gi89161199r_216730834
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CTTAAAAGCTTGAAAATAAAACTTCTTTCCCTACC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTAGTGTCCCTTTCCATATGCGAGTTTTTCTTCCTCTTCCCTATCCTCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 216830834 216944995 4 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 452 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9P2E8	8.2e-149	100.0	E3 ubiquitin-pr...	Homo sapiens
XP_526023	3.5e-148	99.8	membrane-associ...	Pan troglodytes
XP_545636	1.1e-140	87.6	similar to memb...	Canis lupus fam...
XP_001490009	1.9e-136	92.7	membrane-associ...	Equus caballus
XP_001789546	1e-135	92.2	similar to memb...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001841 205 250 PF00097 Zinc finger

HMMSmart IPR011016 204 251 SM00744 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	205	250	PF00097	Zinc finger
HMMSmart	IPR011016	204	251	SM00744	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGGCTCATCTGGTCAACTTTC

Primer_r
: TGTCTTGTCATAGTTCAGCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1450 bp
Genome contig ID	gi89161199r_216730834
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CTTAAAAGCTTGAAAATAAAACTTCTTTCCCTACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTAGTGTCCCTTTCCATATGCGAGTTTTTCTTCCTCTTCCCTATCCTCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	216830834	216944995	4	99.6	Perfect prediction

Primer_f	: TGGCTCATCTGGTCAACTTTC
Primer_r	: TGTCTTGTCATAGTTCAGCAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1399

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information