HUGE

Gene/Protein Characteristic Table for KIAA1401

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07232
Accession No. :	AB037822
Description :	TSR1, 20S rRNA accumulation.
HUGO Gene Name :
Clone Name :	hk09639 [Vector Info]
Flexi ORF Clone :	pF1KA1401
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4107 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 612 bp

Genome contig ID gi51511734r_2073627
PolyA signal sequence
(TATAAA,-17)
+----*----+----*----+----*----+----
GAGTCTAGTTGGTTTACCTATAAAGTTCAGATGAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATACGTGTCCAGTTTGAATTTTCTTATCACTGTGTACACACGCTTCCCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 2173627 2187551 15 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 853 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG72839	100.0	TSR1, 20S rRNA ...	synthetic construct
Q2NL82	99.9	Pre-rRNA-proces...	Homo sapiens
Q5R434	98.0	Pre-rRNA-proces...	Pongo abelii
XP_001086730	97.1	similar to Temp...	Macaca mulatta
AAH19090	99.7	TSR1 protein [H...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D80009	1.8e-13	22.8	KIAA0187

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR012948 277 358 PF08142 AARP2CN

IPR007034 535 822 PF04950 Protein of unknown function DUF663

HMMSmart IPR012948 277 358 SM00785 AARP2CN

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012948	277	358	PF08142	AARP2CN
IPR007034	535	822	PF04950	Protein of unknown function DUF663
HMMSmart	IPR012948	277	358	SM00785	AARP2CN

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCACTGAGCACAATACAAATG

Primer_r
: CCAACTAGACTCCCCTTTCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCACTGAGCACAATACAAATG
Primer_r	: CCAACTAGACTCCCCTTTCAC
PCR product length	: 186 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	612 bp
Genome contig ID	gi51511734r_2073627
PolyA signal sequence (TATAAA,-17)	+--------+--------+----*----+---- GAGTCTAGTTGGTTTACCTATAAAGTTCAGATGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATACGTGTCCAGTTTGAATTTTCTTATCACTGTGTACACACGCTTCCCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	2173627	2187551	15	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA1401

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information