| HUGE |
Gene/Protein Characteristic Table for KIAA0187 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01058 |
|---|---|
| Accession No. : | D80009 |
| Description : | Ribosome biogenesis protein BMS1 homolog. |
| HUGO Gene Name : | BMS1 homolog, ribosome assembly protein (yeast) (BMS1) |
| Clone Name : | ha02920 [Vector Info] |
| Flexi ORF Clone : | pF1KA0187
|
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4181 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 305 bp Genome contig ID gi89161187f_42499822 PolyA signal sequence
(ATTAAA,-19)
GGCCTACAGAAATATCATTAAAATATTTTTTTGTTFlanking genome sequence
(147035 - 147084)
ACTTTTGGCTTAGTAGTTTTCATTAGGGATGAATGCCTGACAATTCTTTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 f 42599822 42646855 22 99.8 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1285 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 10 |
| : Genebridge 4 | |
| : GCTAAGGACCAGAAGAAACAC | |
| : TCCGGGCATCTTCTTCGTCTC | |
| : 109 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
