HUGE

Gene/Protein Characteristic Table for KIAA1409

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05659
Accession No. :	AB037830
Description :
HUGO Gene Name :
Clone Name :	af00533 [Vector Info]
Source :	Human brain (amygdala)
Note :	We replaced fh04461, former representative clones for KIAA1409 with af00533. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 7816 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 430 bp

Genome contig ID gi51511730f_92923762
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ACTCTTGGCAATGCAATAAAAAAAACCGTCACCAT
Flanking genome sequence
(319673 - 319722)
----+----*----+----*----+----*----+----*----+----*
AAGCCAGTGACACCTGACTGAAGCTTTTTGTCTTTATCCTGGGAAAAGTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 93013797 93243433 48 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 2461 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001094916	99.1	similar to CG52...	Macaca mulatta
NP_065869	99.0	hypothetical pr...	Homo sapiens
XP_001095032	98.2	similar to CG52...	Macaca mulatta
XP_001150811	98.3	hypothetical pr...	Pan troglodytes
NP_001074486	94.5	hypothetical pr...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TATTTCTGATGACTCCTTGGG

Primer_r
: CAACAGGGGGACTTATACAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTGAGCTGGGAGTTCTTTGTC
Primer_r	: CAACATTGGTCCTCACAGCAG
PCR product length	: 121 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	430 bp
Genome contig ID	gi51511730f_92923762
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ACTCTTGGCAATGCAATAAAAAAAACCGTCACCAT
Flanking genome sequence (319673 - 319722)	----+--------+--------+--------+--------+----* AAGCCAGTGACACCTGACTGAAGCTTTTTGTCTTTATCCTGGGAAAAGTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	93013797	93243433	48	99.8	Perfect prediction

Primer_f	: TATTTCTGATGACTCCTTGGG
Primer_r	: CAACAGGGGGACTTATACAAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1409

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information