HUGE

Gene/Protein Characteristic Table for KIAA1414

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB037835
Description :	HEAT repeat containing 5B.
HUGO Gene Name :	HEAT repeat containing 5B (HEATR5B)
Clone Name :	fh14368 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5091 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 480 bp

Genome contig ID gi89161199r_36961657
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
ATATACTATGAATAAAATCACAGCATTTTCTAAGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTCCCAAAATGTCCTTATCTTTCTGATGGATCTTTTAGCTTTCATATC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 37061657 37145516 27 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1586 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2D3	100.0	HEAT repeat-con...	Homo sapiens
XP_515406	99.9	hypothetical pr...	Pan troglodytes
XP_001501102	97.4	HEAT repeat con...	Equus caballus
XP_540148	97.0	similar to CG27...	Canis lupus fam...
XP_863392	96.9	similar to CG27...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037737	4.1e-156	56.2	KIAA1316

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000357 362 398 PF02985 HEAT

IPR000357 576 612 PF02985 HEAT

IPR000357 804 840 PF02985 HEAT

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	362	398	PF02985	HEAT
IPR000357	576	612	PF02985	HEAT
IPR000357	804	840	PF02985	HEAT

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCCTTACATACCTTGCTAGAC

Primer_r
: ACAACTCCAGTAACCAACAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	480 bp
Genome contig ID	gi89161199r_36961657
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- ATATACTATGAATAAAATCACAGCATTTTCTAAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTCCCAAAATGTCCTTATCTTTCTGATGGATCTTTTAGCTTTCATATC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	37061657	37145516	27	99.8	Perfect prediction

Primer_f	: GCCTTACATACCTTGCTAGAC
Primer_r	: ACAACTCCAGTAACCAACAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1414

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information