HUGE

Gene/Protein Characteristic Table for KIAA1417

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05478
Accession No. :	AB037838
Description :	Inhibitor of Bruton tyrosine kinase.
HUGO Gene Name :
Clone Name :	fh14782 [Vector Info]
Source :	Human fetal brain
Note :	We replaced hh15303, former representative clones for KIAA1417 with fh14782. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5522 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1186 bp

Genome contig ID gi89161210r_82836675
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
CAGATGTGCAATAAAAAATGATCTTGATCCATTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTAATGTGTGCTTGACATTTTTTACTATATTGACATTTATTATGGAAAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 82936675 83007156 28 99.9 Terminal No-hit

Features of the protein sequence	Description

Length: 1379 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2D0	100.0	Inhibitor of Br...	Homo sapiens
XP_518606	99.4	inhibitor of Br...	Pan troglodytes
XP_001914988	91.7	similar to Inhi...	Equus caballus
XP_539018	91.1	similar to inhi...	Canis lupus fam...
XP_613576	90.5	similar to Inhi...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046813	2.7e-07	31.7	KIAA1593
AB040903	2.2e-06	27.9	KIAA1470
D25215	2.3e-05	30.7	KIAA0032
AB082526	0.00033	27.9	KIAA1995

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 112 124 PR01415 Ankyrin

IPR002110 124 136 PR01415 Ankyrin

HMMPfam IPR002110 77 109 PF00023 Ankyrin

IPR002110 111 143 PF00023 Ankyrin

IPR000408 221 270 PF00415 Regulator of chromosome condensation

IPR000408 273 325 PF00415 Regulator of chromosome condensation

IPR013069 580 714 PF00651 BTB/POZ

IPR013069 783 897 PF00651 BTB/POZ

HMMSmart IPR002110 77 106 SM00248 Ankyrin

IPR002110 111 140 SM00248 Ankyrin

IPR000210 590 770 SM00225 BTB/POZ-like

IPR000210 794 897 SM00225 BTB/POZ-like

ProfileScan IPR002110 77 109 PS50088 Ankyrin

IPR002110 77 161 PS50297 Ankyrin

IPR002110 111 143 PS50088 Ankyrin

IPR000408 168 221 PS50012 Regulator of chromosome condensation

IPR000408 222 273 PS50012 Regulator of chromosome condensation

IPR000408 274 328 PS50012 Regulator of chromosome condensation

IPR000210 590 670 PS50097 BTB/POZ-like

IPR000210 794 862 PS50097 BTB/POZ-like

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	112	124	PR01415	Ankyrin
IPR002110	124	136	PR01415	Ankyrin
HMMPfam	IPR002110	77	109	PF00023	Ankyrin
IPR002110	111	143	PF00023	Ankyrin
IPR000408	221	270	PF00415	Regulator of chromosome condensation
IPR000408	273	325	PF00415	Regulator of chromosome condensation
IPR013069	580	714	PF00651	BTB/POZ
IPR013069	783	897	PF00651	BTB/POZ
HMMSmart	IPR002110	77	106	SM00248	Ankyrin
IPR002110	111	140	SM00248	Ankyrin
IPR000210	590	770	SM00225	BTB/POZ-like
IPR000210	794	897	SM00225	BTB/POZ-like
ProfileScan	IPR002110	77	109	PS50088	Ankyrin
IPR002110	77	161	PS50297	Ankyrin
IPR002110	111	143	PS50088	Ankyrin
IPR000408	168	221	PS50012	Regulator of chromosome condensation
IPR000408	222	273	PS50012	Regulator of chromosome condensation
IPR000408	274	328	PS50012	Regulator of chromosome condensation
IPR000210	590	670	PS50097	BTB/POZ-like
IPR000210	794	862	PS50097	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGCATTCTGGAAGCGTATCTC

Primer_r
: ACTACATCTCCTTTACTCTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1186 bp
Genome contig ID	gi89161210r_82836675
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CAGATGTGCAATAAAAAATGATCTTGATCCATTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTAATGTGTGCTTGACATTTTTTACTATATTGACATTTATTATGGAAAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	82936675	83007156	28	99.9	Terminal No-hit

Primer_f	: AGCATTCTGGAAGCGTATCTC
Primer_r	: ACTACATCTCCTTTACTCTGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1417

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information