HUGE

Gene/Protein Characteristic Table for KIAA1995

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK02059
Accession No. :	AB082526
Description :	Serine/threonine-protein kinase Nek9.
HUGO Gene Name :
Clone Name :	bh00088 [Vector Info]
Flexi ORF Clone :	pF1KA1995
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5492 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2446 bp

Genome contig ID gi51511730r_74518575
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
ATTTCTGTTTTAAATAAACATTTAAGCTCTTAATC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTACTGTGCTTCAGTAAGCCTGTGCATGGACCTTAGTCTCTGGGGATAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 r 74618575 74663483 22 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1011 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAL05428	100.0	NIMA-related ki...	Homo sapiens
Q8TD19	99.9	Serine/threonin...	Homo sapiens
AAL87410	99.8	NIMA-family kin...	Homo sapiens
XP_001097546	99.6	NIMA related ki...	Macaca mulatta
XP_001926782	95.7	similar to Seri...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067488	9.9e-30	42.3	KIAA1901
AB014523	4e-16	33.9	KIAA0623
AB032968	5.4e-16	31.1	KIAA1142
AB018265	7.4e-16	31.4	KIAA0722
AB033090	2.1e-15	30.0	KIAA1264

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 87 331 PD000001 Protein kinase

HMMPfam IPR000719 84 340 PF00069 Protein kinase

IPR000408 476 527 PF00415 Regulator of chromosome condensation

IPR000408 532 579 PF00415 Regulator of chromosome condensation

HMMSmart IPR001245 84 340 SM00219 Tyrosine protein kinase

IPR002290 84 340 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 84 340 PS50011 Protein kinase

IPR000408 420 476 PS50012 Regulator of chromosome condensation

IPR000408 477 530 PS50012 Regulator of chromosome condensation

IPR000408 531 582 PS50012 Regulator of chromosome condensation

IPR000408 583 647 PS50012 Regulator of chromosome condensation

IPR000408 648 700 PS50012 Regulator of chromosome condensation

IPR000408 701 758 PS50012 Regulator of chromosome condensation

ScanRegExp IPR008271 204 216 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	87	331	PD000001	Protein kinase
HMMPfam	IPR000719	84	340	PF00069	Protein kinase
IPR000408	476	527	PF00415	Regulator of chromosome condensation
IPR000408	532	579	PF00415	Regulator of chromosome condensation
HMMSmart	IPR001245	84	340	SM00219	Tyrosine protein kinase
IPR002290	84	340	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	84	340	PS50011	Protein kinase
IPR000408	420	476	PS50012	Regulator of chromosome condensation
IPR000408	477	530	PS50012	Regulator of chromosome condensation
IPR000408	531	582	PS50012	Regulator of chromosome condensation
IPR000408	583	647	PS50012	Regulator of chromosome condensation
IPR000408	648	700	PS50012	Regulator of chromosome condensation
IPR000408	701	758	PS50012	Regulator of chromosome condensation
ScanRegExp	IPR008271	204	216	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCCCACCTTCCTATAAACAGC

Primer_r
: AGAAGATCCCATTGAACAGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2446 bp
Genome contig ID	gi51511730r_74518575
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ATTTCTGTTTTAAATAAACATTTAAGCTCTTAATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTACTGTGCTTCAGTAAGCCTGTGCATGGACCTTAGTCTCTGGGGATAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	r	74618575	74663483	22	99.5	Perfect prediction

Primer_f	: TCCCACCTTCCTATAAACAGC
Primer_r	: AGAAGATCCCATTGAACAGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1995

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information