HUGE

Gene/Protein Characteristic Table for KIAA0623

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01106
Accession No. :	AB014523
Description :	Serine/threonine-protein kinase ULK2.
HUGO Gene Name :	unc-51-like kinase 2 (C. elegans) (ULK2)
Clone Name :	hg04615 [Vector Info]
Flexi ORF Clone :	pF1KA0623
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5808 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2197 bp

Genome contig ID gi51511734r_19518058
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
ATAGCAATAATAAACAAATGCTTTATGTTTCCCTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTATTTTTAAATTTCATATCGTGTTTCATAGAGTGGAAATGTACCAGTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 19618058 19711822 27 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1100 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11220	100.0	serine/threonin...	synthetic construct
Q8IYT8	99.9	Serine/threonin...	Homo sapiens
AAX43266	99.9	unc-51-like kin...	synthetic construct
NP_055498	99.8	unc-51-like kin...	Homo sapiens
XP_511339	99.3	unc-51-like kin...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018265	1.5e-71	52.2	KIAA0722
AB051552	3.7e-12	32.1	KIAA1765
D43636	6.7e-11	32.2	KIAA0096
AB002367	2.1e-10	30.9	KIAA0369
AB082526	2.4e-10	33.6	KIAA1995

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 73 327 PD000001 Protein kinase

HMMPfam IPR000719 73 335 PF00069 Protein kinase

HMMSmart IPR001245 73 335 SM00219 Tyrosine protein kinase

IPR002290 73 335 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 73 335 PS50011 Protein kinase

ScanRegExp IPR000719 79 103 PS00107 Protein kinase

IPR008271 191 203 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	73	327	PD000001	Protein kinase
HMMPfam	IPR000719	73	335	PF00069	Protein kinase
HMMSmart	IPR001245	73	335	SM00219	Tyrosine protein kinase
IPR002290	73	335	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	73	335	PS50011	Protein kinase
ScanRegExp	IPR000719	79	103	PS00107	Protein kinase
IPR008271	191	203	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGCTGGGTACATATTAAGTGG

Primer_r
: AGGACAAAGGATATTCATGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGCTGGGTACATATTAAGTGG
Primer_r	: AGGACAAAGGATATTCATGGC
PCR product length	: 83 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2197 bp
Genome contig ID	gi51511734r_19518058
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- ATAGCAATAATAAACAAATGCTTTATGTTTCCCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTATTTTTAAATTTCATATCGTGTTTCATAGAGTGGAAATGTACCAGTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	19618058	19711822	27	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0623

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information