HUGE

Gene/Protein Characteristic Table for KIAA1425

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB037846
Description :	DNA methyltransferase 1-associated protein 1.
HUGO Gene Name :	DNA methyltransferase 1 associated protein 1 (DMAP1)
Clone Name :	hj01333 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4952 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 54 bp

Genome contig ID gi89161185f_44351747
PolyA signal sequence
(AATAGA,-19)
+----*----+----*----+----*----+----
GCGACGCTGTTATGTAAATAGAGCTGCTGAGTTGG
Flanking genome sequence
(107186 - 107235)
----+----*----+----*----+----*----+----*----+----*
ACCAGGCTGCTTCCTTTTCCTTTCCTTCACTTCTGATGCCCCTAGTGGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 44451747 44458931 11 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 495 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_513103	1.9e-178	99.8	DNA methyltrans...	Pan troglodytes
XP_532609	3.8e-169	97.6	similar to DNMT...	Canis lupus fam...
Q9NPF5	1.4e-167	100.0	DNA methyltrans...	Homo sapiens
CAB66592	1.3e-166	99.4	hypothetical pr...	Homo sapiens
EAX07050	1.5e-166	99.2	DNA methyltrans...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR008468 271 435 PF05499 DNA methyltransferase 1-associated 1

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008468	271	435	PF05499	DNA methyltransferase 1-associated 1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTGTAGAGATGCCTGACCTTG

Primer_r
: TGTAAGTGCTTCTGTGGAGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	54 bp
Genome contig ID	gi89161185f_44351747
PolyA signal sequence (AATAGA,-19)	+--------+--------+----*----+---- GCGACGCTGTTATGTAAATAGAGCTGCTGAGTTGG
Flanking genome sequence (107186 - 107235)	----+--------+--------+--------+--------+----* ACCAGGCTGCTTCCTTTTCCTTTCCTTCACTTCTGATGCCCCTAGTGGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	44451747	44458931	11	100.0	Perfect prediction

Primer_f	: CTGTAGAGATGCCTGACCTTG
Primer_r	: TGTAAGTGCTTCTGTGGAGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1425

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information