HUGE

Gene/Protein Characteristic Table for KIAA1442

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00838
Accession No. :	AB037863
Description :	early B-cell factor 4.
HUGO Gene Name :	early B-cell factor 4 (EBF4)
Clone Name :	hh10127b [Vector Info]
Flexi ORF Clone :	pF1KSDA1442
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 2782 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 897 bp

Genome contig ID gi51511747f_2521689
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGGTGGTGCCCGCCCGGCCTCTCACCTGCCTCCTT
Flanking genome sequence
(167060 - 167109)
----+----*----+----*----+----*----+----*----+----*
GGTGTGAGTTTGCTTTTCTTAGCAGTTCAGCAGCTCTAGGGGAGGCTCCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 f 2621524 2688747 18 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 627 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX10577	1.4e-206	99.5	hCG39626, isofo...	Homo sapiens
CAM20111	6.9e-184	90.3	early B-cell fa...	Mus musculus
BAG10068	9.2e-178	100.0	early B-cell fa...	synthetic construct
XP_001713773	1.8e-177	99.8	early B-cell fa...	Homo sapiens
NP_001103984	1.6e-166	95.2	early B-cell fa...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002909 339 421 PF01833 Cell surface receptor IPT/TIG

HMMSmart IPR002909 338 422 SM00429 Cell surface receptor IPT/TIG

ScanRegExp IPR003523 245 254 PS01345 Transcription factor COE

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002909	339	421	PF01833	Cell surface receptor IPT/TIG
HMMSmart	IPR002909	338	422	SM00429	Cell surface receptor IPT/TIG
ScanRegExp	IPR003523	245	254	PS01345	Transcription factor COE

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTATAACAATGGACTGCGGAC

Primer_r
: CCGCATTCTTCAGGCAGTTCT

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CACTTCCTTTGAGACCTGCAC
Primer_r	: GGAAGACCCCAAATACAGGAG
PCR product length	: 115 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	897 bp
Genome contig ID	gi51511747f_2521689
PolyA signal sequence (None)	+--------+--------+----*----+---- AGGTGGTGCCCGCCCGGCCTCTCACCTGCCTCCTT
Flanking genome sequence (167060 - 167109)	----+--------+--------+--------+--------+----* GGTGTGAGTTTGCTTTTCTTAGCAGTTCAGCAGCTCTAGGGGAGGCTCCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	f	2621524	2688747	18	99.6	Perfect prediction

Primer_f	: GTATAACAATGGACTGCGGAC
Primer_r	: CCGCATTCTTCAGGCAGTTCT
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1442

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information