HUGE

Gene/Protein Characteristic Table for KIAA1447

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04251
Accession No. :	AB040880
Description :	BAH domain and coiled-coil-containing protein 1 (Fragment).
HUGO Gene Name :	BAH domain and coiled-coil containing 1 (BAHCC1)
Clone Name :	fh04686 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5166 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 0 bp

Genome contig ID gi51511734f_76925445
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CAAAGCCAAAGAGCTCTCCCGGAGGCAGCGGCCGC
Flanking genome sequence
(118144 - 118193)
----+----*----+----*----+----*----+----*----+----*
CCTCCGTGGAAAACCGGCCAAAGATCTCAGCCTTCCTGCCCGCCCGGCAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 77025445 77043587 22 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1721 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW89653	99.9	hCG1987554, iso...	Homo sapiens
Q9P281	98.0	BAH and coiled-...	Homo sapiens
BAE27797	75.7	unnamed protein...	Mus musculus
Q3UHR0	75.7	BAH and coiled-...	Mus musculus
NP_940815	75.6	BAH domain and ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058759	0.00064	27.0	KIAA1856

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCAAGAAGGTATCCAGTGAGG

Primer_r
: TTAGGAGTTCGGCTTTACCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: CCR
Primer_f	: AGGAGAGGACGAGGCTATGTG
Primer_r	: AACTCTACGCGGTCTTTGCTG
PCR product length	: 85(500) bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	0 bp
Genome contig ID	gi51511734f_76925445
PolyA signal sequence (None)	+--------+--------+----*----+---- CAAAGCCAAAGAGCTCTCCCGGAGGCAGCGGCCGC
Flanking genome sequence (118144 - 118193)	----+--------+--------+--------+--------+----* CCTCCGTGGAAAACCGGCCAAAGATCTCAGCCTTCCTGCCCGCCCGGCAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	77025445	77043587	22	99.7	Perfect prediction

Primer_f	: CCAAGAAGGTATCCAGTGAGG
Primer_r	: TTAGGAGTTCGGCTTTACCAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1447

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information