HUGE

Gene/Protein Characteristic Table for KIAA1466

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05662
Accession No. :	AB040899
Description :
HUGO Gene Name :
Clone Name :	fj01441 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4520 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1791 bp

Genome contig ID gi89161213f_134412983
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GATGTACACCTAAAAATAAAAACTTTCCTGCATCC
Flanking genome sequence
(104270 - 104319)
----+----*----+----*----+----*----+----*----+----*
AATTCTTCGGTCTCTCTTGTCCCTTAATTTTCGCAACATTTCAAGACAGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 134512962 134517251 1 99.0 Terminal No-hit

Features of the protein sequence	Description

Length: 505 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAP06677	6.9e-89	48.4	pol protein [Hu...	Human endogenou...
ABC26820	6.3e-78	46.8	polymerase [Ret...	Reticuloendothe...
ACJ65653	6.5e-78	46.8	pol protein [Re...	Reticuloendothe...
ABD46829	6.5e-78	46.8	pol protein [Re...	Reticuloendothe...
ABC26818	1.2e-77	46.5	polymerase [Ret...	Reticuloendothe...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037726	5.1e-06	25.0	KIAA1305
AB067512	0.0006	23.8	KIAA1925

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002156 53 148 PF00075 Ribonuclease H

IPR001584 272 425 PF00665 Integrase

ProfileScan IPR002156 13 148 PS50879 Ribonuclease H

IPR001584 272 428 PS50994 Integrase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002156	53	148	PF00075	Ribonuclease H
IPR001584	272	425	PF00665	Integrase
ProfileScan	IPR002156	13	148	PS50879	Ribonuclease H
IPR001584	272	428	PS50994	Integrase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACCAAAGGGGGGAATGAAGTG

Primer_r
: GTTAATGTTTCTTGGGACTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: CCR
Primer_f	: ACCAAAGGGGGGAATGAAGTG
Primer_r	: GTTAATGTTTCTTGGGACTGG
PCR product length	: 192 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1791 bp
Genome contig ID	gi89161213f_134412983
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GATGTACACCTAAAAATAAAAACTTTCCTGCATCC
Flanking genome sequence (104270 - 104319)	----+--------+--------+--------+--------+----* AATTCTTCGGTCTCTCTTGTCCCTTAATTTTCGCAACATTTCAAGACAGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	134512962	134517251	1	99.0	Terminal No-hit

Gene/Protein Characteristic Table for KIAA1466

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information