HUGE |
Gene/Protein Characteristic Table for KIAA1925 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | |
---|---|
Accession No. : | AB067512 |
Description : | Protein ZNF452. |
HUGO Gene Name : | SCAN domain containing 3 (SCAND3) |
Clone Name : | fj02353 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3727 bp
![]() |
The revised DNA sequence was revised to adapt it for the corresponding genomic sequence without any experiments following the alert of coding interruption by GeneMark analysis, because this interruption seemed to be caused by an error of the reverse transcriptase.
cloned DNA seq. | Warning for N-terminal truncation: YES | NO | Warning for coding interruption: YES | NO | |
Length of 3'UTR 280 bp Genome contig ID gi89161210r_28547387 PolyA signal sequence
(ATTAAA,-18) +----*----+----*----+----*----+----
AATCTGTTGATTCTAATATTAAAACATTTGATCTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATATTTTGTGTCTTCTTCTTGTATTTCATTAGCATGTTAAGATTGTAGGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 r 28647387 28655063 3 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1147 aa
This protein sequence is predicted from the revised DNA sequence
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TATTTGTGGAGATGTACTGGC | |
: TGAGAAACGTTGAACACCTGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 6 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |