HUGE

Gene/Protein Characteristic Table for KIAA1925

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB067512
Description :	Protein ZNF452.
HUGO Gene Name :	SCAN domain containing 3 (SCAND3)
Clone Name :	fj02353 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3727 bp
Physical map
Restriction map
The revised DNA sequence was revised to adapt it for the corresponding genomic sequence without any experiments following the alert of coding interruption by GeneMark analysis, because this interruption seemed to be caused by an error of the reverse transcriptase.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES NO

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 280 bp

Genome contig ID gi89161210r_28547387
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
AATCTGTTGATTCTAATATTAAAACATTTGATCTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATATTTTGTGTCTTCTTCTTGTATTTCATTAGCATGTTAAGATTGTAGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 28647387 28655063 3 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1147 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6R2W3	100.0	SCAN domain-con...	Homo sapiens
AAI11743	99.9	SCAN domain con...	Homo sapiens
CAL38739	99.5	hypothetical pr...	synthetic construct
XP_527300	99.4	zinc finger pro...	Pan troglodytes
CAL37757	99.4	hypothetical pr...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037774	2.1e-87	41.3	KIAA1353
AB018309	8.2e-16	23.7	KIAA0766
AB046806	2.2e-05	21.5	KIAA1586

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001584 189 345 PF00665 Integrase

IPR008906 1070 1117 PF05699 HAT dimerisation

ProfileScan IPR001584 188 348 PS50994 Integrase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001584	189	345	PF00665	Integrase
IPR008906	1070	1117	PF05699	HAT dimerisation
ProfileScan	IPR001584	188	348	PS50994	Integrase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TATTTGTGGAGATGTACTGGC

Primer_r
: TGAGAAACGTTGAACACCTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	NO
Warning for coding interruption:	YES	NO

Length of 3'UTR	280 bp
Genome contig ID	gi89161210r_28547387
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- AATCTGTTGATTCTAATATTAAAACATTTGATCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATATTTTGTGTCTTCTTCTTGTATTTCATTAGCATGTTAAGATTGTAGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	28647387	28655063	3	100.0	Perfect prediction

Primer_f	: TATTTGTGGAGATGTACTGGC
Primer_r	: TGAGAAACGTTGAACACCTGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1925

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information