HUGE |
Gene/Protein Characteristic Table for KIAA1586 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00871 |
---|---|
Accession No. : | AB046806 |
Description : | |
HUGO Gene Name : | |
Clone Name : | fj08085 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1586
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4061 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Features of the protein sequence |
Description | |
---|---|---|
Length: 739 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TAGAGATTGGCCCATGTTTGC | |
: CCTCCAGGGCTTAGAACTTAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 6 |
: RH-map | |
: TAGAGATTGGCCCATGTTTGC | |
: CCTCCAGGGCTTAGAACTTAG | |
: 151 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |