HUGE

Gene/Protein Characteristic Table for KIAA1353

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07436
Accession No. :	AB037774
Description :	Zinc finger MYM-type protein 6.
HUGO Gene Name :
Clone Name :	fj01443 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3877 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 122 bp

Genome contig ID gi89161185r_35125170
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
TTGTGTTTTCAGTGATTAAATGTTTTAATAATTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TCCCTTTTTGTTGAGGAATTTAATAATTATGATTGTTATAAATAATTATG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 35225170 35229046 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 640 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX07434	100.0	hCG1812640 [Hom...	Homo sapiens
O95789	99.7	Zinc finger MYM...	Homo sapiens
XP_001166528	99.5	zinc finger pro...	Pan troglodytes
ABF22698	100.0	transposase-lik...	Homo sapiens
BAA91430	100.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067512	7.7e-97	41.1	KIAA1925
AB018309	1.5e-17	22.0	KIAA0766
AB011115	0.00012	21.2	KIAA0543
AB046806	0.00019	22.1	KIAA1586

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGTGCTTGGGATTACTTGTAC

Primer_r
: GTTCTTTATGTATCTCCCCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGTGCTTGGGATTACTTGTAC
Primer_r	: GTTCTTTATGTATCTCCCCAC
PCR product length	: 208 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	122 bp
Genome contig ID	gi89161185r_35125170
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TTGTGTTTTCAGTGATTAAATGTTTTAATAATTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TCCCTTTTTGTTGAGGAATTTAATAATTATGATTGTTATAAATAATTATG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	35225170	35229046	1	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1353

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information