HUGE

Gene/Protein Characteristic Table for KIAA0543

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05609
Accession No. :	AB011115
Description :
HUGO Gene Name :	SCO-spondin homolog (Bos taurus) (SSPO)
Clone Name :	hg04390 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6443 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3106 bp

Genome contig ID gi89161213f_149074210
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TTTTGCTACCTGAATAAAGCAGAGTCTATTTCAAC
Flanking genome sequence
(121290 - 121339)
----+----*----+----*----+----*----+----*----+----*
ACATCTCTGTCTTGTGTGTCCCTAAGCGAGGACCAGGAGCTCAGAGAAGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 149174210 149195498 7 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 1111 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60290	100.0	Zinc finger pro...	Homo sapiens
EAW80026	100.0	hCG16180 [Homo ...	Homo sapiens
XP_001101093	96.0	similar to Zinc...	Macaca mulatta
XP_001494367	85.9	similar to zinc...	Equus caballus
XP_001787729	80.1	similar to zinc...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046806	3.6e-16	22.4	KIAA1586
AB033111	5.1e-09	36.0	KIAA1285
AB058755	6.3e-08	33.5	KIAA1852
AB058709	1.8e-07	46.2	KIAA1806
AB046808	2.6e-07	36.8	KIAA1588

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001909 275 315 PF01352 KRAB box

IPR008906 931 1014 PF05699 HAT dimerisation

HMMSmart IPR006580 77 160 SM00597 Zinc finger

IPR001909 275 335 SM00349 KRAB box

IPR006580 403 486 SM00597 Zinc finger

ProfileScan IPR001909 275 346 PS50805 KRAB box

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001909	275	315	PF01352	KRAB box
IPR008906	931	1014	PF05699	HAT dimerisation
HMMSmart	IPR006580	77	160	SM00597	Zinc finger
IPR001909	275	335	SM00349	KRAB box
IPR006580	403	486	SM00597	Zinc finger
ProfileScan	IPR001909	275	346	PS50805	KRAB box

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 961 FPLLSKLMAVVVCVPISTSCCER 983 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	961	FPLLSKLMAVVVCVPISTSCCER	983	PRIMARY	23

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GGGTCTGACATTCCAAGTAAC

Primer_r
: AGGTATCTTCCAGGACAGGGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGGTCTGACATTCCAAGTAAC
Primer_r	: AGGTATCTTCCAGGACAGGGG
PCR product length	: 109 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3106 bp
Genome contig ID	gi89161213f_149074210
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTTTGCTACCTGAATAAAGCAGAGTCTATTTCAAC
Flanking genome sequence (121290 - 121339)	----+--------+--------+--------+--------+----* ACATCTCTGTCTTGTGTGTCCCTAAGCGAGGACCAGGAGCTCAGAGAAGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	149174210	149195498	7	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA0543

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information