HUGE

Gene/Protein Characteristic Table for KIAA1806

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07459
Accession No. :	AB058709
Description :	Zinc finger protein 333.
HUGO Gene Name :	zinc finger protein 333 (ZNF333)
Clone Name :	fk00438 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3079 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1633 bp

Genome contig ID gi42406306f_14587235
PolyA signal sequence
(ATTAAA,-34)
+----*----+----*----+----*----+----
AATTAAATATAGATACTGACATTTTTTACATTTCC
Flanking genome sequence
(105537 - 105586)
----+----*----+----*----+----*----+----*----+----*
AACAAATTGTTACTTTTATTCTTATAAAGTGATCATCCTTTTCCCTATTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 14687235 14692770 5 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 481 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW84442	1.4e-204	100.0	zinc finger pro...	Homo sapiens
Q96JL9	1.5e-204	100.0	Zinc finger pro...	Homo sapiens
XP_512445	7.6e-203	99.4	zinc finger pro...	Pan troglodytes
CAI56712	1.6e-202	99.4	hypothetical pr...	Homo sapiens
XP_001112454	2e-198	96.9	similar to zinc...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037817	2.5e-54	51.6	KIAA1396
AB058755	2.2e-53	49.9	KIAA1852
AB051497	3.6e-53	46.1	KIAA1710
AB037770	8.4e-53	43.7	KIAA1349
AB046831	9.8e-53	49.7	KIAA1611

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 182 205 PD000003 Zinc finger

IPR007087 210 233 PD000003 Zinc finger

IPR007087 238 261 PD000003 Zinc finger

IPR007087 266 289 PD000003 Zinc finger

IPR007087 294 317 PD000003 Zinc finger

IPR007087 322 345 PD000003 Zinc finger

IPR007087 378 401 PD000003 Zinc finger

IPR007087 406 429 PD000003 Zinc finger

IPR007087 434 456 PD000003 Zinc finger

HMMPfam IPR001909 19 59 PF01352 KRAB box

IPR007087 182 204 PF00096 Zinc finger

IPR007087 210 232 PF00096 Zinc finger

IPR007087 238 260 PF00096 Zinc finger

IPR007087 266 288 PF00096 Zinc finger

IPR007087 294 316 PF00096 Zinc finger

IPR007087 322 344 PF00096 Zinc finger

IPR007087 350 372 PF00096 Zinc finger

IPR007087 378 400 PF00096 Zinc finger

IPR007087 406 428 PF00096 Zinc finger

IPR007087 434 456 PF00096 Zinc finger

HMMSmart IPR001909 19 79 SM00349 KRAB box

IPR015880 182 204 SM00355 Zinc finger

IPR003656 192 235 SM00614 Zinc finger

IPR015880 210 232 SM00355 Zinc finger

IPR015880 238 260 SM00355 Zinc finger

IPR015880 266 288 SM00355 Zinc finger

IPR015880 294 316 SM00355 Zinc finger

IPR015880 322 344 SM00355 Zinc finger

IPR003656 331 375 SM00614 Zinc finger

IPR015880 350 372 SM00355 Zinc finger

IPR015880 378 400 SM00355 Zinc finger

IPR015880 406 428 SM00355 Zinc finger

IPR015880 434 456 SM00355 Zinc finger

ProfileScan IPR001909 19 90 PS50805 KRAB box

IPR007087 182 209 PS50157 Zinc finger

IPR007087 210 237 PS50157 Zinc finger

IPR007087 238 265 PS50157 Zinc finger

IPR007087 266 293 PS50157 Zinc finger

IPR007087 294 321 PS50157 Zinc finger

IPR007087 322 349 PS50157 Zinc finger

IPR007087 350 377 PS50157 Zinc finger

IPR007087 378 405 PS50157 Zinc finger

IPR007087 406 433 PS50157 Zinc finger

IPR007087 434 461 PS50157 Zinc finger

ScanRegExp IPR007087 184 204 PS00028 Zinc finger

IPR007087 212 232 PS00028 Zinc finger

IPR007087 240 260 PS00028 Zinc finger

IPR007087 268 288 PS00028 Zinc finger

IPR007087 296 316 PS00028 Zinc finger

IPR007087 324 344 PS00028 Zinc finger

IPR007087 352 372 PS00028 Zinc finger

IPR007087 380 400 PS00028 Zinc finger

IPR007087 408 428 PS00028 Zinc finger

IPR007087 436 456 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	182	205	PD000003	Zinc finger
IPR007087	210	233	PD000003	Zinc finger
IPR007087	238	261	PD000003	Zinc finger
IPR007087	266	289	PD000003	Zinc finger
IPR007087	294	317	PD000003	Zinc finger
IPR007087	322	345	PD000003	Zinc finger
IPR007087	378	401	PD000003	Zinc finger
IPR007087	406	429	PD000003	Zinc finger
IPR007087	434	456	PD000003	Zinc finger
HMMPfam	IPR001909	19	59	PF01352	KRAB box
IPR007087	182	204	PF00096	Zinc finger
IPR007087	210	232	PF00096	Zinc finger
IPR007087	238	260	PF00096	Zinc finger
IPR007087	266	288	PF00096	Zinc finger
IPR007087	294	316	PF00096	Zinc finger
IPR007087	322	344	PF00096	Zinc finger
IPR007087	350	372	PF00096	Zinc finger
IPR007087	378	400	PF00096	Zinc finger
IPR007087	406	428	PF00096	Zinc finger
IPR007087	434	456	PF00096	Zinc finger
HMMSmart	IPR001909	19	79	SM00349	KRAB box
IPR015880	182	204	SM00355	Zinc finger
IPR003656	192	235	SM00614	Zinc finger
IPR015880	210	232	SM00355	Zinc finger
IPR015880	238	260	SM00355	Zinc finger
IPR015880	266	288	SM00355	Zinc finger
IPR015880	294	316	SM00355	Zinc finger
IPR015880	322	344	SM00355	Zinc finger
IPR003656	331	375	SM00614	Zinc finger
IPR015880	350	372	SM00355	Zinc finger
IPR015880	378	400	SM00355	Zinc finger
IPR015880	406	428	SM00355	Zinc finger
IPR015880	434	456	SM00355	Zinc finger
ProfileScan	IPR001909	19	90	PS50805	KRAB box
IPR007087	182	209	PS50157	Zinc finger
IPR007087	210	237	PS50157	Zinc finger
IPR007087	238	265	PS50157	Zinc finger
IPR007087	266	293	PS50157	Zinc finger
IPR007087	294	321	PS50157	Zinc finger
IPR007087	322	349	PS50157	Zinc finger
IPR007087	350	377	PS50157	Zinc finger
IPR007087	378	405	PS50157	Zinc finger
IPR007087	406	433	PS50157	Zinc finger
IPR007087	434	461	PS50157	Zinc finger
ScanRegExp	IPR007087	184	204	PS00028	Zinc finger
IPR007087	212	232	PS00028	Zinc finger
IPR007087	240	260	PS00028	Zinc finger
IPR007087	268	288	PS00028	Zinc finger
IPR007087	296	316	PS00028	Zinc finger
IPR007087	324	344	PS00028	Zinc finger
IPR007087	352	372	PS00028	Zinc finger
IPR007087	380	400	PS00028	Zinc finger
IPR007087	408	428	PS00028	Zinc finger
IPR007087	436	456	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGATATTGTGTTCAGGGATGG

Primer_r
: CAGAAGCAAGATGGTTATGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1633 bp
Genome contig ID	gi42406306f_14587235
PolyA signal sequence (ATTAAA,-34)	+--------+--------+----*----+---- AATTAAATATAGATACTGACATTTTTTACATTTCC
Flanking genome sequence (105537 - 105586)	----+--------+--------+--------+--------+----* AACAAATTGTTACTTTTATTCTTATAAAGTGATCATCCTTTTCCCTATTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	14687235	14692770	5	100.0	Perfect prediction

Primer_f	: AGATATTGTGTTCAGGGATGG
Primer_r	: CAGAAGCAAGATGGTTATGAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1806

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information